1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nat2105 [25]
3 years ago
6

Which two statements about forces are true?

Biology
1 answer:
fiasKO [112]3 years ago
6 0

Answer: A. Every force has an equal but opposite force.

D. Forces organize and affect how matter moves

Explanation:

For every interaction, we should note that we have forces that act on the two objects that are involved. Also, Forces organize and affect how matter moves.

The idea that every force requires matter to touch is wrong. There are some non-contact forces that doesn't need physical touch e.g friction, pull. Also, there are balanced as well as unbalanced forces.

Therefore, the correct options are A and D.

You might be interested in
What’s the name of the “super continent” that broke up about 225 million years ago?
Zepler [3.9K]
The name of the super continent is Pangaea 
5 0
3 years ago
Read 2 more answers
What is the elevation of point C
Readme [11.4K]
The answer is "1500ft"
5 0
3 years ago
Read 2 more answers
The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
liubo4ka [24]

The mRNA generated below was produced in the  <em><u>nucleus </u></em>of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

brainly.com/question/11430054

8 0
3 years ago
Which nursing actions are necessary to prepare a perinatal patient for research?
Bezzdna [24]
The necessary actions are 
<span>- Inform the patient about her rights
</span><span>- Obtain consent from the patient
</span>
To be ethical, we should fully give informations to the perinatal patient about research without concealing anything. Including the potential side effects of the research and the payment/benefit that they patients would get if they agree to be a part of it
6 0
4 years ago
What must happen before meoisis can begin
kotegsom [21]

Answer:

Before meiosis actually begins, the DNA that is packaged into chromosomes must be fully copied.

8 0
3 years ago
Read 2 more answers
Other questions:
  • During which stage of postmortem decomposition do the muscles stiffen and then relax initial decay
    8·2 answers
  • Other organelles inside a cell, consisting mostly of membranes, make up the endomembrane system. This system of organelles acts
    7·2 answers
  • Which of the following is an example of an environment with a carrying capacity that has been overloaded?
    12·1 answer
  • 8. Cystic fibrosis is caused by a recessive allele. The frequency of this allele is 0.1 in a population of 2,500.
    12·1 answer
  • The rebirth of science and learning during the fifteenth century is termed the?
    14·2 answers
  • PLEASE NEED YOUR HELP I CANT FAIL PLEASEEEE I DONT NEED AN EXPLANATION I JUST WOULD LIKE THE ANSWER PLEASE!
    5·1 answer
  • Two organisms that occupy many of the same niches are most likely
    10·1 answer
  • what structure is less likely to suffer severe damage during an earthquake a high-rise steel frame Hotel built on segments or a
    5·1 answer
  • Can u help me please
    10·1 answer
  • A mutation that occurs in the gametes of an organism will most likely be transferred to which of the following.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!