1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
arsen [322]
4 years ago
10

Nonrandom mating tends to _______ the frequencies of ______ genotypes.

Biology
2 answers:
scZoUnD [109]4 years ago
6 0
The correct answer would be A or the first option
Jet001 [13]4 years ago
6 0
Hey! The correct answer choice is A.) increase, homozygous

I took Edguniuty test and got it right ;)

Thank You <3
You might be interested in
Muscles of the internal organs and glands are controlled by the _____ nervous system.
Lesechka [4]

Answer:

Also know as the <u>skeletal</u> nervous system. The part of the <u>peripheral</u> nervous system that controls the glands and the muscles of the internal organs (such as the heart).

8 0
3 years ago
Read 2 more answers
what is the ultimate source of energy of almost any terrestial (land) food chsin or food web ? what process converts this energy
jasenka [17]
The sun is the ultimate source of energy and the process is Photosynthesis.
4 0
4 years ago
What does a capital letter, such as T represent in a Punnett square?
postnew [5]

D. Dominant gene I believe

3 0
4 years ago
Read 2 more answers
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Any time a scientific theory is challenged, it means it's not a good theory.Do you agree with this statement? Explain
vfiekz [6]
False. Any time a scientific theory is challenged, it means it's not a good theory. And this statement is not valid. In theoretical models, they are revisited when there are further studies and discoveries found in a certain area where they can be remodeled and reintegrated instead of disregarding its credibility. Models, theories and paradigms are not challenged but rather encouraged, they are supported in many studies since these theories and models were created in order for us to understand a certain phenomenon but it would likely help the scientific society to be updated in the new forms or spheres of improvement rather than discouragement.  



8 0
3 years ago
Other questions:
  • Energy comes from the sun while matter comes from the earth true or false
    13·2 answers
  • A material you are testing conducts electricity but cannot be pulled into wires. It is most likely a _____.
    9·2 answers
  • True or False: All cells need ATP to function.
    12·1 answer
  • Examine the diagram of the food web described in the passage. Using arrows, how would you label the direction of energy flow thr
    14·1 answer
  • A bond formed by the electrical attraction between two oppositely charged ions is a(n)_____.
    6·2 answers
  • Which of the following would differ if you compared the same reaction taking place with and without enzyme?
    5·1 answer
  • What determines the inherited traits an organism has?
    14·1 answer
  • Which of the following has mechanical energy?
    11·2 answers
  • Plz answer the questions for me!!!!!!!
    8·1 answer
  • According to the modem theory of evolution, closely related species of organisms share:
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!