1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
12

Help pls plsssssssssssssssssssssssssssssssssssssssssssssssss I give brailest

Biology
2 answers:
Rzqust [24]3 years ago
8 0
What is the question?
allochka39001 [22]3 years ago
6 0

Answer:

there is no question

Explanation:

You might be interested in
Which term best describes the movement of water thought cell membrane
Alexandra [31]

Osmosis is the best term


5 0
3 years ago
What is species distribution?
docker41 [41]

Answer:

Species distribution is the manner in which a biological taxon is spatially arranged. ... Species distribution is not to be confused with dispersal, which is the movement of individuals away from their region of origin or from a population center of high density.

6 0
3 years ago
Read 2 more answers
What is selective breeding?
soldi70 [24.7K]

Answer:

A

Explanation:

7 0
3 years ago
Read 2 more answers
Replicate the following (write the complementary DNA strand);<br><br> ATT ACG CGC
pogonyaev

Answer:

GCC GTA TAT

Adenine pairs with guanine.

Cytosine pairs with thymine.

Hope it helps!

3 0
2 years ago
Read 2 more answers
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Other questions:
  • The process by which two species, for example, a flower and a pollinating insect, evolve in response to each other is called ___
    6·1 answer
  • How are the problems different
    13·1 answer
  • A 23-year-old computer programmer comes to the office for an annual examination. She has recently become sexually active and wan
    14·1 answer
  • Describe why a fresh carrot or celery will produce a "snap" sound when you break it. A vegetable that is not fresh will not make
    5·1 answer
  • A combined sewer system carried___ to a sewage treatment plant. A. Household waste water B. Rain water C. Lawn run of D. All the
    5·1 answer
  • What does it mean that humans can change materials?
    10·1 answer
  • Apakah hubungan antara keamatan cahaya dengan kadar transpirasi?<br>​
    11·1 answer
  • If some can help me with my biology final the whole 25
    13·2 answers
  • What is everyone's view on time travel? Easy points. :)
    15·2 answers
  • A muscle that opposes or reverses a particular movement is a.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!