<span>The answer to this question would be Receipt of breach notice.
In case of a data breach, the provider of the healtcare should inform the patient about what information breached and who might breach it. The provider that failed to do this can get some punishment like locking the electronic system.</span>
1 is b or 1/4 (I'd recommend checking a punnet square too)
Answer:
The question to be asked an investigated when observing a structure under the microscope to determine whether it is living is if it has a nucleus if eukaryote or nucleoid if prokaryote.
Explanation:
The major organelle that must be present in all living cells is the nucleus or nucleoid and the protoplasm. The observation of the cell under the microscope will show the subcellular entity, nucleus/nucleoid, more pronounced than other organelles in the cell. The nucleus house the necessary information for the maintenance and reproduction, which is mainly the genetic information that dictates the translational protein products that are needed to build another aspect of the cells. Therefore, when such a tiny structure is placed under the light microscope under the view of oil immersion, the nucleus of the cell should be visible if it is a living structure.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
