1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
qaws [65]
3 years ago
5

In this Landsat image of a rain forest, healthy vegetation appears red and deforested areas appear light blue. What explains the

Biology
1 answer:
lutik1710 [3]3 years ago
7 0

Answer:

Colors are assigned to different reflected bands electromegnetic waves.

Explanation:

You might be interested in
The number-one way to prevent the spread of disease is _____.
Ratling [72]
Wear a mask or get a shot
5 0
3 years ago
Why is the digestive system broken into many parts
Travka [436]
Because each part does a unique step in the system. An example would be that the mouth and stomach breakdown the food, but the small and large intestine absorb nutrients and water into the bloodstream.
6 0
3 years ago
Which of the following will make it harder in the future to develop sustainable methods for humans using resources?
exis [7]
The answer is B. More humans will populate the Earth.
6 0
3 years ago
Using "i" statements: O A. Always makes your point to the other person OB. Starts arguments OC. Helps eliminate name-calling OD
irinina [24]

Answer:

aa is a good place to start and 3333333333333333 to get out of Daviess and you will pay renttry a lot more than that you and your family and you can afford to be a little more hour than

6 0
3 years ago
Which statement describes redshifts?
babunello [35]

the answer is B :) youre welcome

5 0
3 years ago
Read 2 more answers
Other questions:
  • DNA replication occurs
    15·1 answer
  • Laboratory techniques for randomly linking together amino acids typically generate an insoluble polypeptide, yet a naturally occ
    13·1 answer
  • What would you do if you found an alien in your living room? (Check all that apply.)
    7·2 answers
  • Which of the following groups of animals only uses internal fertilization?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • The unit measure that we use for Acceleration is....
    8·1 answer
  • Describe the six main classes of algae
    8·1 answer
  • Which two parts does a cow eye have that human eye does not
    6·1 answer
  • When you donate blood, you give around one pint. How much blood do you have in your body to start with?.
    10·1 answer
  • 4. The cells of all organisms undergo similar processes to maintain homeostasis. What must ALL cells do in order to maintain hom
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!