Answer:
Actin and myosin are completely overlapped
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
The main driver of a climate zone is the amount and directness of sunlight that reaches the Earth's surface. In the tropical regions, there is a fairly constant amount of sunlight throughout the year. The maximum sun angle is also higher above the horizon.
Answer:
The answers are
A:There are three domains
D:The domains include Bacteria, Archaea, and Eukarya.
F:There are six kingdoms.
Explanation:
I did on my ingenuity
Complete question:
You will find the image of the skulls in the attached files.
Answer:
1) 2 similarities between each of the skulls might be the presence of the nasal spine, and the interdental space.
2) The size of the skull seems to be the most noticeable change in skull anatomy between the dawn horse and the modern horse.
Explanation:
- Each of the nasal bones in horses ends in a protuberance named "the nasal spine". These spines converge in the distal portion of the bone. These spines and the incisive bone delimitates the space called the naso-incisor notch. In the attached figure you will see the nasal bone in red and the nasal spines. This structure is present in all the skulls in the same position.
- The interdental space is the space left between the front teeth and the back teeth. It is useful to recognize a male from a female in modern horses. This space can be found in all the skulls. You will see it in blue in the image.
The biggest change in skulls between the dawn horse and the modern horse is the size. The skull keeps the original shape or very similar shape but varies in length and height.