1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
3 years ago
8

Do you now notice any signs of growth? In which part of the ginger piece do you

Biology
1 answer:
vampirchik [111]3 years ago
8 0

is there a picture near the question?

You might be interested in
Which describes step three of a muscle contraction?
olga55 [171]

Answer:

Actin and myosin are completely overlapped

5 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
3 years ago
Describe the relationship between the Sun and Climate Zones.
GalinKa [24]
The main driver of a climate zone is the amount and directness of sunlight that reaches the Earth's surface. In the tropical regions, there is a fairly constant amount of sunlight throughout the year. The maximum sun angle is also higher above the horizon.
6 0
3 years ago
How are living things organized into domains and kingdoms check all that apply
Paha777 [63]

Answer:

The answers are

A:There are three domains

D:The domains include Bacteria, Archaea, and Eukarya.

F:There are six kingdoms.

Explanation:

I did on my ingenuity

5 0
3 years ago
Read 2 more answers
1. Give 2 similarities between each of the skulls that might lead to the conclusion that these are all related.
Andreas93 [3]

Complete question:

You will find the image of the skulls in the attached files.

Answer:

1) 2 similarities between each of the skulls might be the presence of the nasal spine, and the interdental space.

2) The size of the skull seems to be the most noticeable change in skull anatomy between the dawn horse and the modern horse.

Explanation:  

  • Each of the nasal bones in horses ends in a protuberance named "the nasal spine". These spines converge in the distal portion of the bone. These spines and the incisive bone delimitates the space called the naso-incisor notch. In the attached figure you will see the nasal bone in red and the nasal spines. This structure is present in all the skulls in the same position.  
  • The interdental space is the space left between the front teeth and the back teeth. It is useful to recognize a male from a female in modern horses. This space can be found in all the skulls. You will see it in blue in the image.  

The biggest change in skulls between the dawn horse and the modern horse is the size. The skull keeps the original shape or very similar shape but varies in length and height.  

3 0
3 years ago
Other questions:
  • Why is ab cba the next 0.c
    12·1 answer
  • What is the next step in the scientific method following data collection
    13·1 answer
  • Is a fat replacer used in food processing that can bind to fat-soluble vitamins and thereby reduce their absorption?
    10·1 answer
  • which term describes a type of trait that is usually expressed only when an organism has two identical alleles for the trait
    8·2 answers
  • In a typical data table, the first column of data represents the <br> variable.
    10·1 answer
  • Some lifespan developmentalists use a(n) ____________ approach, drawing on several perspectives.
    13·1 answer
  • Many bird species have seasonal behaviors that cause them to _______ or change their location.
    7·1 answer
  • Which of the following is a specific variant of a character?
    12·1 answer
  • The male tubes that transport sperm from the testes are called?
    6·2 answers
  • What is the main advantage of chronometric dating over relative dating?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!