The study of human populations is called Demography. Sorry it’s late.
<span>Answer: a) a series of anatomical traits that distinguish Cro-magnon features from Neandertals.</span>
<span>Neanderthals (Homo neanderthalensis) were first discovered in Germany in 1856 and are believed to emerged between 100,000 and 200,000 years ago. </span>
<span>Significant differences found in the human and </span>Neanderthal includes<span>: 1) their DNA, 2) the brain of a Neanderthal had a raised larynx and was also bigger, and 3) Compared to modern humans, Neanderthals had bigger and muscular body but with shorter legs.</span>
Cro-magnon is<span> the earliest known Western European example of our species who lived 35,000 and 10,000 years ago. They are believed to be actually modern in every anatomical respect. They are much like us.</span>
<span>Neanderthal and Cro-magnon were believed to overlap in Europe for a thousand years but long-term interbreeding was not seen. </span>
Answer:
10 B and 11 C thats what I got
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation: