1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Masja [62]
3 years ago
8

A phospholipid . Select an answer and submit. For keyboard navigation, use the up/down arrow keys to select an answer. a has bot

h polar and nonpolar regions b is made up of a triglyceride bonded to a phosphate group c is a building block of ATP d can donate both cations and anions in solution
Biology
1 answer:
just olya [345]3 years ago
4 0

Answer:

A phospholipid

a. has both polar and nonpolar regions.

Explanation:

Phospholipids, as amphipathic molecules, consist of a glycerol molecule, two fatty acids, and a phosphate group that is modified by an alcohol.  The phosphate group is the negatively-charged hydrophilic (water-loving) polar head, which face outward and are attracted to the intracellular and extracellular fluid.  The fatty acids are the uncharged, hydrophobic (water-fearing) nonpolar tails, which face the inside, away from the water and meet in the inner region of the membrane.

You might be interested in
Different between GNP and GNI.​
Y_Kistochka [10]

Answer:

The main difference is that GNP (Gross National Product) takes into account net income receipts from abroad. ... GNI (Gross National Income) = (similar to GNP) includes the value of all goods and services produced by nationals – whether in the country or not.

Mark as brainliest

4 0
3 years ago
Read 2 more answers
Which statements best describe the role of glucagon and insulin in this scenario? Glucagon was secreted by his pancreas before h
Lyrx [107]
After he ate, glucagon from the cookies increased his blood sugar levels

Insulin was secreted after he ate the cookies because his blood glucose was high.
6 0
3 years ago
Read 2 more answers
Suppose you were in charge of sending an unmanned space probe to a new planet in search of life. The probe would be able to coll
Svetlanka [38]

Answer:

Option D, a test for the presence of cells that contain DNA

Explanation:

As we know all living organisms are made up of cells and DNA is the basic genetic material that codes for protein and traits with an organism. If even a single cell with DNA is detected on the extraterrestrial planet then it will be clear that it has life on it or the environmental conditions are favorable to support life. Cells are microscopic and hence can be seen through microscope which can be installed easily on a probe.

Hence, option D is correct

8 0
3 years ago
Two of the tenets of the cell theory are:all living things consists of one or more cells and the cell is the smallest units of l
mestny [16]
The generally accepted parts of modern cell theory include: All known living things are made up of one or more cells. All living cells arise from pre-existing cells by division. The cell is the fundamental unit of structure and function in all living organisms
8 0
3 years ago
Farmer Tom only breeds the largest hogs, the fastest horses, and the cows 1 point
Marta_Voda [28]

Answer:

Artificial Selection

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • In what phase of meiosis are sister chromatids separated and pulled to opposite ends of the cell?
    7·2 answers
  • A virus is a tiny, infectious particle that can reproduce only by infecting a host cell. ... Nor do viruses have cells: they're
    11·1 answer
  • If a tRNA molecule has an anticodon which reads AUG, what was the codon of the mRNA molecule?
    7·1 answer
  • Define ethics and describe why it is so important for science
    6·1 answer
  • Plss help I’m not tryna fail this test
    9·1 answer
  • Which statement illustrates bias in scientific research?
    9·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which shell adaptation did you choose for part two and why? Discuss the results and the effectiveness of the adaptation.
    8·1 answer
  • Why are lipids better suited than carbohydrates for long-term energy storage?.
    5·1 answer
  • List three things that can bring life to a barren island
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!