1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
2 years ago
7

Organisms can be made up of many _____________, which could be arranged into ________________, which can make up _______________

_____, organs can be part of an _______________ _____________________. These are __________________ ___________ ___ _______________________.
Biology
1 answer:
zimovet [89]2 years ago
7 0

Answer:

cells, multicellular organisms,not sure

You might be interested in
How many cells are there in the human body and how many microorganisms are there in a human body?
nydimaria [60]
As of 2014, it was often reported in popular media and in the scientific literature that there are about 10<span> times as many microbial cells in the human body than there are human cells; this figure was based on estimates that the human microbiome includes around </span>100 trillion<span> bacterial cells and an adult human</span>
5 0
3 years ago
Read 2 more answers
How do the finches of the Galapagos Islands demonstrate evolution?
bixtya [17]

The finches adapted over time to better suit their environment that they were in -- the size and shape of their beaks changed as a result of natural selection.

4 0
3 years ago
Read 2 more answers
Sexual reproduction produces offspring ___.
Anarel [89]
A. You will be genetically unique in your own way but similar to your parents
6 0
3 years ago
Read 2 more answers
The cellular organelles with inheritance independent of the nucleus are the _____________ and the ____________ .
Alexxx [7]
Chloroplasts and Mitochondria is your answer 
6 0
3 years ago
The nurse is caring for a 2-year-old child who has been hospitalized after being injured in an automobile accident. during the a
LUCKY_DIMON [66]
That the pain level is not too high, as the child is not screaming, crying, or showing signs of broken limbs/fractures/concussions...etc....

But a correct procedure should still be done in order to make sure nothing is out of place, as there could be internal bleeding/injuries.

Hope this helps!!!
5 0
3 years ago
Other questions:
  • Seasonal changes can be important to reproduction because ___________.
    10·1 answer
  • What are 2 types of root systems in plants?
    5·1 answer
  • How long does it take photosynthesis to occur?
    9·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How does the moon look
    6·2 answers
  • How does using a ramp make work easier when loading a piano onto a truck three feet above the ground
    12·2 answers
  • A scientist crossed a tall pea plant with a short pea plant. Of the offspring, 13 were tall and 12 were short, write the ratio o
    5·1 answer
  • How did the underwater volcano form?
    6·2 answers
  • Which of the following activities required the most commercially produced power?
    12·1 answer
  • why do plant cells occasionally switch from noncyclic electron flow (nef) to cyclic electron flow (cef)?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!