1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
14

PLEASEEEE HELPPPPPPPPPPP

Biology
1 answer:
Julli [10]3 years ago
6 0

Answer:

D The processes of transcription and translation, including the genetic code, are the same in the beetle as in nearly all other organisms.

Explanation:

Transcription is the cellular process where a specific DNA fragment called 'gene' is used as a template to create a complementary RNA molecule, usually a messenger RNA (mRNA). Subsequently, this mRNA is then used to synthesize a polypeptide chain (i.e., a protein) in the ribosomes. In eukaryotic organisms such as, in this case, beetles, both transcription and translation are essentially the same processes, and the genetic code used in the protein synthesis is also the same. The difference between beetles is the variation among DNA nucleotide sequences (genomes) which are used as templates to synthesize mRNAs, thereby their final products (proteins) are also different.

You might be interested in
Which organelle requires CO2, water, and sunlight to function?
dem82 [27]
A. Chloroplast would be the answer hope this helps dear! if u can please put me as brainliest!
7 0
2 years ago
Which best explains how the collisions of materials in space contribute to the formation of layers in protoplanets? The material
photoshop1234 [79]

Answer:

The collisions release heat, which results in the heating and subsequent melting, sinking, and rising of materials.

Explanation:

The collisions literally release heat (kinetic energy). Energy from collision increased temperature, causing materials to melt.

4 0
3 years ago
Read 2 more answers
Plz help me plzzzzzzzzzzzzz​
telo118 [61]

Answer:

4.i.True

4.ii.False

4.iii.True

8 0
2 years ago
Which sentence describes how an animal might interact with the abiotic factors in its environment?
alexandr1967 [171]

Answer:

It inhales oxygen

Explanation:

6 0
3 years ago
Read 2 more answers
Ant lions are small insects that dig funnel-shaped depressions in sandy areas. They hide in the dirt at the bottom of the funnel
Over [174]

Answer:

Predator-prey relationship

Explanation:

A predator prey relationship is one in which interactions usually with consequential effects occurs between two different species. One species usually feed on the other. The species being fed on are the prey while the species being fed is the predator. In this context, the prey is the ant and the predator s are the ant lions.

5 0
3 years ago
Read 2 more answers
Other questions:
  • We need lots of energy to do the things we want to do: keep our houses warm, drive cars, run computers, grow and harvest food. T
    15·1 answer
  • What is the function of antithrombin found in the blood and on the cells lining blood vessels?
    15·1 answer
  • Which of these polymers is responsible for your inheritance?
    5·2 answers
  • What is the name of the place a goat lives?<br>Think hard though one?​
    7·2 answers
  • If a star is shown to be 33.11 trillion kilometers away, how many light years would that be?
    14·1 answer
  • Water is referred to as a polar molecule. <br><br> Describe the characteristics of a polar molecule.
    11·1 answer
  • How does ground water get polluted?
    6·2 answers
  • How are babies made? Please explain. they did not teach me so thing stuff in health class
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Which of the following is an example of convenience sampling?
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!