1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
12

Why does the first sentence state that carbon is the backbone of life on Earth?

Biology
2 answers:
motikmotik3 years ago
8 0
“All life on Earth needs carbon.” would be your answer

All living things are made of carbon and carbon is also found in multiple randomly occurring compounds on earth too.

Ly and hope your having a good day/night !
inn [45]3 years ago
4 0

All life on Earth needs carbon.

hope this helps, please mark brainliest :)

You might be interested in
Which one(s) contribute the most to the mass of a plant? I. Soil II. Carbon III.Water A) I only B) II only C) I and III only D)
allochka39001 [22]
<span>D) II and III only is what i would put</span>
5 0
3 years ago
Read 2 more answers
Ordinary cell division produces two daughter cells that are genetically identical. This type of cell division is important for a
Ratling [72]

Answer:

C) production of sperm and eggs

Explanation:

Sperms and eggs are the male and female gametes respectively. Formation of sperms and egg cells require meiotic cell division. Meiosis in sperm mother cells and egg mother cells reduces the chromosome number of half in the sperms and eggs. Meiosis also adds new gene combinations in these gametes by the process of crossing over.  

Mitosis cannot reduce the chromosome number to half in the sperms and eggs. Absence of crossing over in mitosis leads to the formation of genetically identical progeny cells from mitosis.  

Hence, mitosis can not form sperms and egg cells.  If it does, the sperms and egg cells would not have genetic variations and there would be doubling of chromosome number with each round of sexual reproduction.

8 0
4 years ago
The _____ are pure forms of matter that cannot be broken down into simplier substances.
bearhunter [10]
The elements are pure forms of matter that cannot be broken down into simpler substances.
8 0
3 years ago
A research scientist writes a paper on the initial regrowth of a forest after a fire has damaged the entire ecosystem. Which tit
algol [13]
The Regrowth after Fire
7 0
3 years ago
What type of attractions between water molecules occur because of water's diplor nature
leva [86]

Answer:

Explanation:

The barnacles are only able to attach themselves to surfaces in the water. Since the surface is limited, barnacles are attaching themselves to the other barnacles, crowding the rock. The muscles were not able to grow or attach themselves off the surface of the rock. Same thing with the mussels that are growing on the rock. So not only barnacles are crowding the rock, but Mussels as well are crowding the rock.

3 0
3 years ago
Read 2 more answers
Other questions:
  • PLEASE HELP ME
    11·1 answer
  • What is the full meaning of dna
    11·2 answers
  • Activation of the parasympathetic nervous system _____ salivation and decreases blood pressure.
    11·1 answer
  • Microfilaments are made from a ball-shaped protein called _____.
    12·2 answers
  • The moon’s origin can be explained by a theory called the impact theory.
    5·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Once all the giant planets were discovered, scientists could compare their properties to learn something about them. Study this
    13·1 answer
  • Kudzu is a vine that was brought to the us from japan to prevent erosion once here kuduz became invasvie what role does kuduz mo
    12·1 answer
  • Please help I’ll mark you as brainliest if correct
    9·1 answer
  • with reference to structural features describe how pollination occurs in a named insect pollinated flower​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!