1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlad1618 [11]
3 years ago
9

Immediately upon fertilization, a hormone called ________ begins to be released; pregnancy tests measure the level of this hormo

ne in a woman's urine to determine pregnancy
Biology
2 answers:
Delicious77 [7]3 years ago
8 0

Answer: Human chorionic gonadotropin (hCG)

Explanation:

Human chorionic gonadotropin (hCG) is the hormone which can be detected in the blood and urine of a pregnant women. This hormone is made by the placental cells. The blood test or urine test is performed to check the progress of pregnancy that is the development of the fetus. The placenta is the outer membranous layer which covers and protects the developing fetus.

jeka943 years ago
4 0
It's "hCG". I hope this helps!
You might be interested in
What are the three main factors of the cell theory, and which parts of the previous cell theory can be disproven?
Hoochie [10]

structure, function and organism should be it sorry if i am wrong

4 0
3 years ago
Which word describes the amount of matter an object contains? altitude, density, mass,pressure
leonid [27]

The Correct Answer to the following question is <u>Mass</u>. Mass measures the amount of matter in a substance or an object.

5 0
3 years ago
Read 2 more answers
44. The nervous system is controlled by the
Pachacha [2.7K]

Answer:

It's controlled by the Brain

8 0
3 years ago
Read 2 more answers
Bone would be found as a part of which type of tissue?
ExtremeBDS [4]

Answer: Bone is made of osseous tissue, and osseous tissue is a type of connective tissue.

<em>I hope this helps, and Happy Holidays! :)</em>

6 0
3 years ago
Read 2 more answers
True or false does Pressure increases from Earth's surface toward the center of Earth.
Dima020 [189]

The answers are; TRUE

Pressure increase towards earth’s interior because the further deeper you go the higher the rock layers above that apply pressure towards the center of the earth by gravity.  In addition , due to this increasing pressure, temperatures also increase because the two parameters are directly proportional.


4 0
3 years ago
Other questions:
  • During which phase of meiosis does crossing over occur?
    5·2 answers
  • One example of incomplete dominance and one example of codominance
    15·1 answer
  • Why would capillary action be critical for plants to survive?
    5·2 answers
  • ________ refers to the way that sensory information is interpreted and consciously experienced; ________ refers to what happens
    13·1 answer
  • Ecology involves the study of all of the following except for the interactions between
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is scientific consensus
    11·2 answers
  • You are hired by Murphey Farms to decrease the backfat in their hogs. The current hog population has a mean backfat content of 2
    11·1 answer
  • Which pathway crosses over in the medulla?
    9·1 answer
  • _____ is on the shoulders of the police and investigation team.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!