How many sets of chromosomes do diploid organisms have?

Biology

1 answer:

Hunter-Best [27]3 years ago

6 0

2 sets of chromosomes

You might be interested in

Which of the following is a cause of a DNA mutation?

Reika [66]

DNA Mutation is caused by the alteration of single base units in DNA, or the deletion, insertion, or rearrangement of larger sections of genes or chromosomes. Thus, the correct answer is option D.

1.DNA Mutations are caused by environmental factors known as mutagens.

2.Types of DNA mutagens include radiation, chemicals, and infectious agents.

3.DNA Mutations may be spontaneous in nature.

7 0

2 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved