The growth or tuning of plant root toward or away from moisture
Answer:
For question 20. I believe the answer is C. There would be more iguanas with webbed feet.
Explanation:
It states the iguanas have adapted to different habitats on the island. The iguanas that have webbed feet will be better at getting food in water, but slower on land. So if the land starts to disappear and turns into more water, the iguanas with webbed feet will have a higher chance of survival. Meaning the iguanas with out webbed feet will die out as a population.
The answer is.......4!!
Explanation: All you have to do is 12/3.0 and you will get four!
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
