1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
12

A student is working on a lab where they are trying to identify an unknown substance. the student decides to smell the solution

by taking a big breath over the test tube. they immediately start to cough and their lungs are burning.
Biology
1 answer:
Rasek [7]3 years ago
6 0

Complete question:

A student is working on a lab where they are trying to identify an unknown substance. The student decides to  smell the solution by taking a big breath over the test tube. They immediately start to cough and their lungs are  burning.

  • PRECAUTION:
  • RESPONSE:

Answer and Explanation:

Many chemicals might be recognized by their smell. Some of them might be inoffensive, some others might cause slight damage and some others might be very harmful to the person that inhales them.

In the exposed example, the solution probably damaged the respiratory tract, causing inflammation and irritation.

There are some issues to take into account to avoid an accident by inhaling a chemical:

<u>Precaution</u>:

  • Study the security rules of the laboratory
  • Always read the label of the substance
  • Ask the teacher or the person in charge, about the correct procedure
  • Proceed in the correct way, by driving the smelly vapors with your hand toward your nose. Never breathe directly over the test tube.

In case of accidents by inhaling you should:

<u>Response:</u>

  • Take the affected person out of the laboratory
  • Look for an airy place where the affected person might breath
  • Call an emergency service
  • Explain exactly what the affected person did and the chemicals that the person inhaled.
You might be interested in
What process involves the turning off or on the genetic information of a cell
JulijaS [17]

Differentiation is the process that involves the turning off or on the genetic information of a cell.

Differentiation is the process in which a young and immature cell changes into a specialized cell (a mature form with distinct function). Generic embryonic cells undergo differentiation to become specialized cells through the process of gene expression in which specific combination of genetic instructions are turned on (expressed) or off (repressed).


Read more on Brainly.com - brainly.com/question/4934261#readmore

4 0
3 years ago
What is the importance of photosynthesis?
stiks02 [169]
The plants absorb light energy into chemical energy. This energy is used by the plant for fuel. The byproduct of photosynthesis is Oxygen. That is why plants are so beneficial for air quality
7 0
2 years ago
The _____ was a worldwide effort to map the complete human genetic code.
77julia77 [94]
<span>The answer is 'The Human Genome Project". The Human Genome Project (1990-2003) was an international effort to map the compete human genetic code, the sequence of nucleotide base pairs that make up human DNA, collectively call the human genome. The official date of completion was timed to coincide with celebrations of the 50th anniversary of James D. Watson and Francis Crick's discovery of the double-helical structure of DNA (April 12, 2003). The Human Genome, the molecular instruction book of human life, contains the essential sequence of three billion base pairs of DNA.</span>
7 0
3 years ago
Which statement describes an element? Check all that apply.
11111nata11111 [884]
<span>An element is a pure substance that cannot be broken down into a simpler form.

All elements are listed on the periodic table of elements.

An element symbol begins with a capital letter; if there is a second or even third letter, it is a lowercase letter.</span>
7 0
2 years ago
What are the cell organelles that burn glucose and provide atp for active transport?
8090 [49]
Its mitochondrion the answes.
3 0
3 years ago
Other questions:
  • A large asteroid impact occurs, kicking up dust that blocks the Sun and prevents plants from photosynthesizing. What would most
    15·1 answer
  • "the adrenal medulla secretes more norepinephrine than epinephrine." <br> a. True <br> b. False
    10·1 answer
  • The two most prevalent forms of ocean pollution are...(choose two)
    9·2 answers
  • What color indicates a positive result before the addition of zinc? after?
    14·1 answer
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • Which blood type can be transfused into a patient who has blood type A–?
    6·1 answer
  • Which is the definition of an embryo?
    5·2 answers
  • Which of the following observations best supports the claim that mitochondria evolved
    6·1 answer
  • Which is not a function of the respiratory system? A. It warms air entering the body. B. It exchanges oxygen and carbon dioxide.
    9·2 answers
  • How is the cytoplasm divided between the two cells that result from mitosis in plant cells? In animal cells?​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!