1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Komok [63]
3 years ago
13

A neap tide occurs when:

Biology
1 answer:
AveGali [126]3 years ago
5 0
Should be the moon moves 90 degrees in it I wish you best of luck
You might be interested in
PLZ I NEED HELP I WILL GIVE BRAINLIEST 1.Which material(s) or shapes and colors were used to represent the phosphate-sugar backb
aliina [53]

Answer:1. Phosphate= pink 2. blue

Explanation:

8 0
3 years ago
Which of the following tools was responsible for advancing our knowledge of cells over the past 400 years?
damaskus [11]

Answer: This is life science right? If it is the answer is the microscope

Explanation:

6 0
3 years ago
Read 2 more answers
PICTURE BELOW PLZ ANSWER
Elodia [21]
1 Met or Start (start codon)
2 Ala
6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
3 years ago
This is the greatest effect of the westernization and commoditization of culture.
ziro4ka [17]
The greatest effect of the westernization and commoditization of culture is that they created a global culture that allows competing marketers to drive down product costs. The answer to your question is A. I hope this is the answer that you are looking for and it comes to your help.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Xylem and _______________ are the two types of tissue that comprise a plant's vascular tissue.
    14·1 answer
  • The lipid components of cellular membranes often include:
    13·2 answers
  • What are the three stages of aerobic cellular respiration?
    11·2 answers
  • identify two cell structures that are missing from Clara’s model and the function of those cell structures. (e.g. ribosome)
    14·1 answer
  • Sea water, which has a pH of 8, has a higher concentration of _____
    10·1 answer
  • Lipids commonly contain fatty acids. What are the two parts of a fatty acid? Check the correct answers below.
    15·1 answer
  • Environmental laws such as the Clean Air and the Clean Water Acts are an
    6·2 answers
  • How can you convert energy into another source ? ​
    11·1 answer
  • How does hybridization and artificial/selective breeding differ from GMOs?
    6·1 answer
  • Following a lengthy marathon, a runner feels out of breath and is experiencing muscle soreness. Explain
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!