1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
navik [9.2K]
3 years ago
9

Minerals have an ordered internal atomic arrangement. what does this mean?

Biology
1 answer:
vladimir1956 [14]3 years ago
6 0
<span>Minerals have an ordered internal atomic arrangement which means that the atoms which make up the mineral are arranged in an ordered geometric pattern or also known as the crystal structure. Thus, it can be concluded that all minerals are crystals. The crystal structure is the same for the same type of mineral. For example, every piece of quartz found anywhere have the same crystalline structure.  </span>
You might be interested in
I need help with this question
Lostsunrise [7]
The correct answer would be D
8 0
3 years ago
Read 2 more answers
13. Which layer would have the oldest fossils, a layer deep underground or a layer close to
Irina-Kira [14]

Answer:

I believe a layer deep underground would have older things, because the ground could erode over time causing the fossil to sink into the ground.

6 0
2 years ago
Which situation is the best example of translational motion? a ballerina standing on one foot a coin spinning on a desk a car in
I am Lyosha [343]

Answer:

A coin spinning on a desk.

7 0
2 years ago
Read 2 more answers
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What hormonal change occurs after fertilization that causes the endometrial lining to remain intact so that the fertilized egg c
krek1111 [17]
The pituitary gland secretes follicle stimulating hormone, which acts on the follicles and stimulates them to produce progesterone.
3 0
2 years ago
Other questions:
  • Skin and muscle cells in humans have 46 chromosomes how many chromosomes will be present in a typical egg cell
    11·2 answers
  • Which of the following is transcribed into RNA?
    12·2 answers
  • There are five basic types of emergencies that every hunter should know about. which emergency is listed here?
    5·2 answers
  • Can someone help me with these two ?.s
    7·2 answers
  • What chemical caused the decline of the eagle population
    12·1 answer
  • When a parent cell makes several nuclei and divides to make several daughter cells, it is called _____. meiosis mitosis binary f
    15·2 answers
  • Ms.Caroll went to the doctors office with pain in her right shoulder blade and learned she was having a gallbladder attack. Your
    7·1 answer
  • Using a MOLECULAR CLOCK, clock, scientists are able to estimate the amount of time that two species have been evolving independe
    14·1 answer
  • During the cell cycle, specifically G1 interphase, a cell must reach a sufficient size and produce enough ATP in order to A) und
    5·2 answers
  • What are the missing two words? In aerobic respiration, glucose and oxygen are used up and __________ __________, water and ener
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!