1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liberstina [14]
3 years ago
6

Please help me on this

Biology
1 answer:
aev [14]3 years ago
6 0
Diabetes and cancer not sure about cancer though, hope I am right
You might be interested in
How are endocrine system and nervous system similar?
Fofino [41]
Hello,

The answer is "one is what controls functions in the body the other one is what helps the body feel things in order to have the other system control the pain and lets the brain know so it can react and have the cells repair the damage done to the body".

Reason:

Endocrine Systems: It provides functions for the body.

Nervous System: It lets the body feel and reacted to something that can damage the body.  

So basically a person touch's a hot stove which causes the nervous system to send a message to the brain telling it that it hurts which is where the endocrine system comes in and provides the function to allow the hand to move quickly away from the heat in order to protect the body.

If you need anymore help feel free to ask me!

Hope this helps!

~Nonportrit
5 0
3 years ago
Hormones are chemicals made in the soil that affect parts of plants.<br> a. True<br> b. False
vampirchik [111]

Hormones are chemicals made in the soil that affect parts of plants. The statement is false.

<h3>How are gibberellins able to affect other parts of the plant?</h3>

Gibberellins stimulate the growth of shoots which increase the biomass and vegetative growth of plants. If vegetative growth increases, the root biomass is also increases.

So we can conclude that other parts of the plant are also affected due to gibberellin because it stimulates the growth of shoots which is the upper portion of the plant.

Learn more about hormones here:

brainly.com/question/4678959

#SPJ1

8 0
1 year ago
A client is to have a hip replacement in 3 months and does not want a blood transfusion from random donors. what option can the
Natalka [10]
The answer is Bank autologous blood. It is simply the giving blood. For instance, patients planned for non-crisis surgery might be qualified to give blood for themselves that will be put away until the surgical technique. Amid the time of "capacity", the body is making more blood.
5 0
3 years ago
At birth Himalayan rabbits are usually
tiny-mole [99]

Answer:

C

Explanation:

because i took the test and got it right

5 0
3 years ago
In the reaction ______ H2 + N2 ----&gt; 2 NH3, what coefficient should be placed in front of H2 to balance the reaction?
schepotkina [342]

2NH3 is equivalent to N2 + H6 since the 2 at the beginning gets distributed to both atoms. Knowing this you can rewite the equation as

H2 + N2 = H6 + N2

The N2 can cancel out leaving

H2 = H6

You now have to ask ‘2 times what equals 6?’ The answer is obviously 3 at this point.


Answer: C. 3


5 0
3 years ago
Other questions:
  • The _____________ has (have) a large role in the regulation of blood pressure.
    11·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Imagine that a chrome contains the following chromosome: ZYXWVUT. What type of mutation happens to produce ZYXWWVUT?
    7·1 answer
  • Which movement of substances through a cell membrane against a concentration gradient requires energy?
    13·1 answer
  • Which muscles work in pairs? <br> 1. cardiac muscles <br> 2. skeletal muscles <br> 3. smooth muscles
    13·1 answer
  • Which names match the letters? Choices are: Chromatid, Chromosome, DNA, Eukaryotic cell, Gene, Nitrogen bases and Nucleus.
    8·1 answer
  • Given what we know about Mendelian genetics, what is the genotype of pea plants with white flowers? White is a recessive trait w
    6·1 answer
  • 3. It is a genetic code that gives us all of our physical
    12·1 answer
  • Hi guys can you guys help me with this question plsss​
    7·2 answers
  • For an enzyme to be able to catalyze a reaction, the active site must —
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!