1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fgiga [73]
3 years ago
8

Check all ways below to ensure that the bases in RNA are properly paired.

Biology
2 answers:
valentinak56 [21]3 years ago
8 0
 B. Make sure the letter U is substituted for the letter T.
C. Make sure that A matches U and that C matches G.

Ainat [17]3 years ago
6 0

The right answer are B (it means the letter U will replace the letter T) and C.

RNA (ribonucleic acid) is obtained from DNA through transcription.

RNA is complementary to the template strand of the DNA (antisense strand), according to Watson and Crick pairing rules (AU / T and CG) and is therefore identical to the coding strand of the DNA (sense strand), the riboses and uraciles (present only in RNA).

You might be interested in
Help <br> Nucleic acid <br> Certain protein<br> Cell membranes<br> Certain carbohydrates
viktelen [127]
Certain Protiens, amino acids form protiens
8 0
3 years ago
A fox is a type of mammal that is related to dogs. How does a fox most likely respond to hot air temperatures in a way that ecto
sveta [45]

Answer:

By panting or breathing heavily.

Explanation:

<em>An ectothermic animal is one whose body temperature depends on the temperature of the external environment.</em>

The body of ectotherms regulates temperature depending on the temperature of the external environment where such animal finds itself.

Hence, when the temperature of the external environment rises as a result of hot air, the body of an ectotherm (that is homeothermic, that is, maintain a relatively constant body temperature irrespective of the temperature of the external environment) will adjust so as to keep its temperature relatively constant.

Dogs generally pant (breathe heavily) to bring their body temperature back to normal whenever it rises beyond normal due to rigorous physical activities or high external temperature.

<em>Hence, a fox will most likely pant in response to hot air temperature just like dogs.</em>

5 0
3 years ago
In Drosophila, the genes for body coloration and eye size are on different chromosomes. Normal-colored bodies are dominant to eb
Yuri [45]

Answer:

225 flies

Explanation:

Let gene for body colour : A

Let gene for eye type : B

Parent 1 : normal body and normal eyes = AABB

Parent 2: ebony body and eyeless = aabb

F1 : AABB X aabb = AaBb ( all have normal body and normal eye )

F1 progeny is self crossed given that the two genes are on different chromosomes which means they show independent assortment:

AaBb X AaBb =

A_B_ = normal body, normal eyes = 9

aaB_ = ebony body, normal eyes = 3

A_bb = normal body, eyeless  = 3    

aabb = ebony body, eyeless  =   1

Hence the ratio is 9 : 3 : 3 : 1

Out of the 400 flies:

(9/16) * 400 = 225 flies have normal body colour and normal eyes

7 0
3 years ago
How might the study of meteorites help astronomers determine the origin of meteoroids?
olganol [36]

Answer:

Through the study of meteorites, their chemical composition of silicates—material made of silicon and oxygen. Others contain metal—nickel and iron. Knowing what the meteorite was composed of lets you know where it came from. Chondrites are composed of hardened lava - this is occurred at the beginning of the solar system (4.5 mya). Carbonaceous chondrites contain carbon and water which formed away from the sun.

Explanation:

4 0
3 years ago
Where do humans fit in the food web?
adoni [48]

Answer:

We are omnivores

Explanation: omnivores eat a mixture of plants and herbivores

4 0
3 years ago
Read 2 more answers
Other questions:
  • This type of selection means selective breeding of plants and animals
    7·2 answers
  • What is formed during the metabolic reactions of cellular respiration?
    11·1 answer
  • This is a substance that is required in large amounts for survival and sustainability.
    5·1 answer
  • 5.
    9·1 answer
  • The DNA in a cell's nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well
    12·1 answer
  • Pollution in the _______ will have the greatest effect on human health.
    6·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What is an example of an object that affects gravity<br> on Earth?
    15·1 answer
  • Which of the following is most likely to happen to a liquid substance when the temperature is increased?
    8·1 answer
  • Over population can lead to ecological degradation and increased extinction True or False
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!