1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liq [111]
2 years ago
10

By analyzing past episodes of the quiz show, you realize that you will probably need 600 points to defeat Kimberly. You also not

ice that, on average, you only feel confident enough to respond to 12 of the 20 questions on a typical episode. So, if you respond to only 12 questions when you’re on the show, which two equations describe your winning scenario? Select all the correct answers. 100x − 200y = 600 x + y = 600 100x − 200y = 12 x − y = 600 x + y = 12
Biology
1 answer:
ra1l [238]2 years ago
5 0

Answer:

100x − 200y = 600 and x + y = 12

Explanation:You can win the quiz show with 600 points. Remember that correct responses are worth 100 points and incorrect responses are worth -200 points. So, you need your total points from each correct response, x, minus your total points for each incorrect response, y, to equal 600:

100x − 200y = 600.

If you only respond to 12 questions, you need the total number of correct responses, x, plus the total number of incorrect responses, y, to equal 12:

x + y = 12.

Together, these two equations describe one way you can win.

You might be interested in
When we breathe in and out normally during rest, this is called “quiet” inspiration (and expiration). It is also called tidal vo
topjm [15]

Answer: the amount of air that normally enters the lungs during quiet breathing, which is about 500 milliliters.

Explanation:

5 0
3 years ago
What happens when the cell outgrows the cell membrane
Jet001 [13]

Answer:

Plasma membrane acts as a selectively permeable barrier between cell components and external environment. If plasma membrane breaks down, it would result in the release of cellular components including cell organelles and cytoplasm in the external environment ultimately leading to the cell death.

5 0
2 years ago
What that determines if a cell is eukaryotic. *
Dmitry_Shevchenko [17]
To determine whether a cell is a eukaryotic or
prokaryotic cell, one can observe certain features.
If the cell in the question possesses a well-defined
or definite nucleus and have membrane-bound
organelles such as mitochondria, chloroplasts,
Golgi apparatus, endoplasmic reticulum, the cell is
eukaryotic. If the cell has nucleoid or indefinite
nucleus and without membrane-bound cell
organelles, the cell is prokaryotic. If ribosomes in
a cell are the 80S (S=Svedberg units) type, the cell
is eukaryotic and if ribosomes are 70S type then it
is prokaryotic.
6 0
2 years ago
Read 2 more answers
Which statement best describes the path of the paper airplane?
Andrei [34K]

Answer:

a paper plane also known as and paper aeroplane in American English or paper aeroplane in British English is it toy aircraft usually a glider made out the single folded sheet of paper or paper boat a simple noise heavy paper plane truth like a dot is also known as paper

6 0
2 years ago
Different between maize and mango in root system​
tia_tia [17]

Answer:difference:

1)mango root system​

Mango is having a well-defined Tap root system which can extend up to 20 feet (6 meters ). Taproots are the roots consists of one thick, cylindrical main root, known as the primary root, from which further branches of roots arises known as the secondary and the tertiary roots.

2)maize root system​

Maize forms a complex root system comprising embryonic and post‐embryonic roots.  Later in development the post‐embryonic shoot‐borne root system becomes dominant and is responsible together with its lateral roots for the major portion of water and nutrient uptake.

5 0
3 years ago
Other questions:
  • Which most common cause of sleep deprivation in the hospital should the nurse consider when planning care? 1. fragmented sleep 2
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • 3. List two behavioral adaptations that Darwin observed<br><br> PLZ HELP FAST
    13·1 answer
  • If water was a non polar molecule how would the properties of water be different
    8·2 answers
  • Anyone good in Biology?
    13·1 answer
  • How might the events that have occurred upstream at the glomerulus affect Starling forces so that they promote fluid uptake into
    14·1 answer
  • The San Andreas Fault is known for which of the following?
    6·1 answer
  • A mutation in which segments of a gene are removed is known as this type of mutation
    10·1 answer
  • 1. A phospholipid has a head made up of a glycerol molecule attached to a single , which is attached to another small molecule.
    10·1 answer
  • 2018 liu comparative study of phrenic and partial ulnar nerve transfers for elbow flexion after upper brachial plexus avulsion a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!