Answer:
For mitosis, the DNA content of the daughter cells and the mother cell will always be identical. Since the number of cells have doubled, so has the DNA. The 16 chromosomes in the mother cell will be duplicated, then the duplicates split and evenly divided into the daughter cells. The 16 chromosomes in each daughter cell will be non-duplicated at first.
Explanation:
yan po sagot ko hope it help to you po
Answer: Higher concentration; Lower concentration.
Explanation: The food that we eat undergoes digestion and breaks down into smaller components.
These small components of the food needs to be absorbed first by the process of diffusion.
The water molecules along with the electrolytes are absorbed from an area of its higher concentration in the lumen is transported to area where its concentration is very low.
Hence, the correct answer is diffusion, which is responsible for the transportation of products from one place (higher concentration) to another parts (lower concentration)in the body.
Answer:
The correct option is A
Explanation:
To determine if water temperature has an effect on weathering of sedimentary rocks, different number (perhaps three) of identical sedimentary rocks should be obtained and then individually placed in different water temperatures (with at least one of the "water volumes" used for each having a temperature close to the room temperature so as to be used as the control).
Thus, each of the identical sedimentary rock can be broken into three and placed individually; as in one part of the rock in 20 °C of water (control), another part of the rock in 40 °C and another in 60 °C of water.
This above procedure should be repeated for the remaining two other identical sedimentary rock to confirm if there is any effect.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
