1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
2 years ago
8

Please help me. Thank you :()

Biology
1 answer:
PSYCHO15rus [73]2 years ago
5 0
1. Complete dominance
2. Incomplete dominance
3. Codominance
You might be interested in
When comparing genomes from different species, scientists are often interested in the genome density, or the number of genes per
Setler79 [48]

The human genome density ranges between 12-15 genes per Megabase pairs. This is because humans have approximately 2000 genes in a total of approximately 3 billion base pairs. However, some primitive organisms have an even larger gene density than humans. An example is bacteria with gene densities ranging between 100 – 500 genes/Mb. Gene density is therefore not a good characteristic in determining the complexity of an organism.






3 0
3 years ago
Read 2 more answers
What factors improve soil fertility
Kruka [31]

here are majorly 12 factors influence Soil fertility

Infiltration of water.

Soil structure.

Active Soil life.

Content of organic matter.

Minerals present in the soil.

Acidity or Soil pH.

Water Retention capacity of soil.

Water draining ability of the soil.

(google)


6 0
2 years ago
What does the release or absorption of energy indicate?
Rainbow [258]

The release of absorption is CHEMICAL CHANGE. A chemical change is a type of change in which a new product is produced. Heat is either released or absorbed during a chemical change, and this heat change indicates the bonds have been broken and rearrange. Do the answer is C. CHEMICAL CHANGE.

MARK ME BRAINIEST

4 0
3 years ago
Read 2 more answers
Can organisms can have different proteins in their cells for a particular feature
AnnyKZ [126]

Answer:Variation in traits can be caused by variation in protein molecules within individuals' cells. Protein molecules' structures affect their function and the way they connect to other molecules.

Explanation: ^^^ hope it helps :)

8 0
3 years ago
A 14-year-old girl sprained her ankle. She rates her pain 5/10. On examination, she has moderate tenderness and swelling with de
pochemuha

Answer:

Grade II

Explanation:

  • When there is either a partial or complete tearing on ligaments that are responsible for supporting the joint of the ankle then it causes an ankle sprain.
  • Based on the exam findings as well as the loss in functionality of the ankle, an ankle sprain can be categorized as grade I, II or III.
  • In the given situation the 14-year-old girl has a grade II ankle sprain which is characterized by an incomplete tear of the ligaments along with moderate pain (as she rates it 5/10), moderate tenderness, loss of range of some functions, and swelling.
  • All of the characteristics of the sprain resemble those of the grade II ankle sprain tear and hence, it is characterized as a grade II ankle sprain.
5 0
3 years ago
Other questions:
  • Which planet is smallest Mercury Venus or Earth
    14·2 answers
  • When a sperm cell and an egg emerge, they undergo the process of fertilization and give rise to a?
    8·1 answer
  • Suppose you are studying two stars. Both stars have the same apparent magnitude, but star A has a greater absolute magnitude tha
    12·2 answers
  • Why does hurricane season occur from late spring through fall in the Atlantic region?
    12·2 answers
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • What was different about the atomic theory proposed by Niels Bohr?
    5·1 answer
  • Palm oil and coconut oil are more like animal fats than are other plant oils. Because they _____ than other plant oils, they may
    6·1 answer
  • 1 All of the following processes move carbon out of the biosphere and into the atmosphere, geosphere, or hydrosphere except:
    9·1 answer
  • If anyone could complete this timeline in order, left to right, that'd be much appreciated :)
    8·2 answers
  • Do fatty acid synthesis and degradation occur in the same location of the cell?.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!