1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
10

Please help me!!!<3 What are 2 limits of natural selection? Please explain why the limit.

Biology
1 answer:
Brums [2.3K]3 years ago
8 0

1. natural selection acts on existing traits because you can not evolve into something you didn't have

2. original structures evolve to accomplish new function in order to survive

You might be interested in
t elevatUsing species C as a reference, you find that there are more genetic differences between species A and species C than be
Julli [10]

Answer:

Speciation was allopatric or peripatric, but would depend on the number of individuals that dispersed from the original populations.

Explanation:

  • There are two types of speciation: allopatric and peripatric.
  • Allopatric speciation occurs when the species of same population gets isolated that results in lack of gene flow.
  • From the isolated population, new species are formed then it is known as the peripatric speciation.
  • All these isolation of populations and formation of new species depends upon the initial or original group of species that was dispersed.
5 0
2 years ago
NEED AN ANSWER ASAP
MissTica

Answer:

Switching to renewable energy sources such as wind and solarExplanation:if you are not useing renewable then your useing the oppsite wich is bad

5 0
2 years ago
Mendel used
padilas [110]
Experiments in general are more reliable when a greater sample size is used. When using a small sample size, a mistake or fluke can greatly effect the outcome of the experiment. With a large sample size, there is more data to understand averages and deviations to the average data. The average will likely be more accurate with more data, which would make his sample size more reliable.
3 0
2 years ago
Read 2 more answers
Compare types of models. Which model of the human digestive system is most detailed?
ikadub [295]

Answer:

i think rhe answer should be c but im not sure

8 0
2 years ago
Question 5 (1 point)
Alla [95]

Answer:

A. The reindeer population exceeded its carrying capacity.

Explanation:

8 0
3 years ago
Other questions:
  • A population of mice lives in a city. the largest mice tend to be killed by predators and the smallest mice cannot compete for f
    8·1 answer
  • What can go wrong with a cell wall?
    10·2 answers
  • Is there a correlation between heart rate and blood pressure?
    7·1 answer
  • Which body system has a function most similar to the role the lysosome plays for a cell?
    13·2 answers
  • What process takes place in chloroplasts?
    5·2 answers
  • what can I use for the nucleus and cytoplasm of a 3D animal cell model? Note: This model has the contents inside a plastic resea
    13·2 answers
  • What types of things do ocean currents carry
    12·1 answer
  • 1. ASSERTION AND REASONING QUESTIONS:
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Can someone please answer this for me !!
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!