1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mrrafil [7]
3 years ago
8

Does your body get all its energy from the sun

Biology
2 answers:
Rus_ich [418]3 years ago
7 0
Yes, and no. We all should know by know we do need the sun to survive, but we also need for energy is oxygen and the food we eat.
Hunter-Best [27]3 years ago
5 0
Indirectly yes. 

Plants need sunlight to photosynthesize. We eat the plants/vegetables which give us glucose. Glucose is needed for respiration. One of the products of respiration is energy.

The equation of photosynthesis:
Carbon dioxide + Water ----> Glucose + Oxygen

The equation of respiration:
Oxygen + Glucose ----> Energy + Carbon dioxide + Water
You might be interested in
What gender is this duck?
Dominik [7]

Answer:

Female

Explanation:

Females typically don't have the curly tail at the end and this photo shows there are not any so I'm pretty sure it's a female.

7 0
3 years ago
What are the 5 roles of bacteria in nature?
Anuta_ua [19.1K]
Bacteria are involved in oxygen and food production, environment recycling and cleanup, and in health maintenance and medicine production.
7 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
How is blood different after it is pumped through the capillaries in the intestines?
ololo11 [35]

Answer:

As blood moves through the capillaries, the oxygen and other nutrients move out into the cells. Then waste matter from the cells goes into the capillaries. As the blood leaves the capillaries, it moves through the veins. Veins merge into larger tubes to carry the blood back to the heart.

Explanation:

brainiest pls

6 0
3 years ago
Which of the following structural changes is not typically seen in a cell that is undergoing apoptosis? Choose one: A. The cytos
barxatty [35]

Answer:

The correct answer will be option-D

Explanation:

Apoptosis is the process which leads to the death of the cell which is programmed and thus is known as the programmed cell death.

The death of a cell takes place when the cell experiences the lack of survival signals either due to the need to kill the cell or some genetic defects in DNA contained in cells.

The cell which undergoes apoptosis process can be easily marked by their shape as it gets shrunk, the cytoskeleton of the cell collapses, irregular bulges called blebs and the disassembly of the nuclear envelope.

Since the cell shrinks instead of swelling, therefore, option-D is the correct answer

6 0
3 years ago
Other questions:
  • What is the function of DNA and where is it found in a eukaryote cell?
    6·2 answers
  • PLEASE HELP ASAP
    5·1 answer
  • 16
    7·1 answer
  • + Create
    12·1 answer
  • Why are proteins so important? What are some of the things that they do?
    10·1 answer
  • Thick, ngid outer wall
    11·1 answer
  • I’m not sure about this can somebody help me
    10·1 answer
  • This is an example of a frameshift mutation.
    9·1 answer
  • red-green colorblindeness occurs more commonly in men than it does in women. using this information, which chromosome do you sup
    14·1 answer
  • !!!!!!H-E-L-P!!!!!!!!!! How do index fossils help scientists establish how old rocks and other fossils are? In your answer, incl
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!