1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Cerrena [4.2K]
3 years ago
9

As a car is slowed, most of its kinetic energy is converted by the brakes to:

Biology
1 answer:
Georgia [21]3 years ago
8 0

Answer:

potential energy!

When slowing an object down the kinetic energy is converted into potential energy. This means the car is either not in motion or slowly getting to a stopping point.

Remember! Newton's first law states that every object will remain at rest or in uniform motion in a straight line unless compelled to change its state by the action of an external force!

You might be interested in
A chronic bone disease that is characterized by the abnormal breakdown of bone followed by abnormal bone formation is known as
Sidana [21]

Answer:

Paget's disease

Explanation:

  • When cellular deforming and remodelling of many bones takes place and this occurs as a chronic condition then this is known as Paget's disease.
  • There is excessive breakdown of bone as well as disorganised formation of new bones.
  • Such problem leads to weakening of the bone due to which complications such as deformity, fracture and arthritis occurs.
  • The disease does not spread from one bone to another and the entire skeleton is not affected in such a disease, it only affect few or more bones.
  • There is currently no known cure for the disease.
4 0
3 years ago
Describe an important role of organisms such as fungi and bacteria:
Triss [41]

Answer:

wast and minerals break down and reproduce.

Explanation:

such as fungi and bacteria: Fungi and bacteria help other things such as wast and minerals break down and reproduce. They are very important role of organisms. Without them our grounds would be full of trash and non broken down minerals.

6 0
3 years ago
What is cellular respiration and what are it’s major components
Musya8 [376]
Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert biochemical energy from nutrients into ATP (adenosine triphosphate), and then release waste products. <span>There are </span>3 major<span> steps in </span>cell respiration:<span> glycolysis, Krebs Cycle, and the electron transport chain.</span>
5 0
3 years ago
Is mixing a physical or chemical change?
Triss [41]
Sometimes you mix different substances and you don't  make  new substances but mostly of the time you do make new substances , so the answer is chemical change.
6 0
3 years ago
17. Advantages of using tidal power include:
Oksi-84 [34.3K]

c my brotha y'w prob alr took da quiz

7 0
3 years ago
Other questions:
  • Where is Earth located in relation to the sun?
    6·1 answer
  • ________ is the main form in which carbon dioxide is carried in the blood.
    5·1 answer
  • Describe the structure of the layers of the skin (pp.178-184)
    11·1 answer
  • What is the greatest danger to a patient who has had damage to the skin? excessive muscle contractions in the damaged area loss
    10·2 answers
  • What functional characteristics make viruses useful for genetic research
    10·2 answers
  • In the epidermal layer of the skin, where would you expect to find the greatest number of cells in m phase of the cell cycle?
    8·1 answer
  • 2. A man has type A blood and his wife has type B blood. A physician types the blood of their four children
    11·1 answer
  • Fertile individuals that readily move from one geographic location to another contribute to.
    11·1 answer
  • The photograph shows an alarm clock ringing.
    15·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!