1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BlackZzzverrR [31]
3 years ago
15

List the rocks in order from oldest to youngest.

Biology
1 answer:
Romashka-Z-Leto [24]3 years ago
7 0

Answer:

Start from the bottom and go up.

You might be interested in
Which of the following represents a duplication in the DNA sequence A-G-T-C-T?
dimulka [17.4K]

Answer:

wym i canr see the examples

Explanation:

6 0
3 years ago
Read 2 more answers
The mechanisms responsible for producing our experience of depth are also responsible for our perception of:
aivan3 [116]

The one responsible for producing experience of depth is responsible for illusions. Illusions are images of which things aren’t the usual or they don’t depict an image that it is considered to be usual. It is some sort of imagery or perceiving something that exist though it is different in form.

6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
This is a process by which water is brought into the water table to replace water that has been taken out through wells
KengaRu [80]

The correct answer is B. Recharge.

Water recharge is the movement of water from land surface to the water table as a result of rain fall over large areas and also through the movement of water from surface water bodies to the ground water system and is less uniform. Ground water recharge can be done naturally through the water cycle and human-induced.  


6 0
3 years ago
Read 2 more answers
What is the organism that kills and eats other organisms for food called?
ANTONII [103]
Predator. hope this helps you out
7 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is NOT a tissue found in the stem
    8·1 answer
  • How do autotrophs and heterotrophs obtain the materials needed to build needed macromolecules ( 2 different sources for autotrop
    10·2 answers
  • BEST ANSWER GETS BRAINLIEST!!!
    7·2 answers
  • The hydrosphere is predominantly made of A. gaseous air. B. frozen water. C. solid rock. D. liquid water.
    14·2 answers
  • Describe at least two events during meiosis that increase the genetic diversity of the daughter cells produced
    6·1 answer
  • How many times longer is DNA than it is wide?
    11·1 answer
  • Plz help thanks ! Question is - ADH THEN ACTS ON THE KIDNEY TO?
    7·1 answer
  • What color(s)of light will drive photosynthesis by green plan most efficiently?
    7·1 answer
  • 13. How do stem cells become specialized to absorb nutrients from food as
    8·1 answer
  • Arrange the steps of phagocytosis in the correct order: A. Phagosome B. Physical Contact C. Digestion D. Phagolysosome E. Outflo
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!