1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ganezh [65]
2 years ago
5

How do the size and shape of human canines compare with chimp canines

Biology
1 answer:
blsea [12.9K]2 years ago
7 0

Answer:

Human canines are blunt and small in size, while chimps have big and sharp canines.

Explanation:

Chimps' mouths are larger than humans' mouths. Chimps have a flat palate; and bigger and sharper canines than humans. Also, there is a space between these teeth and the teeth at the front of the mouth. On the other hand, humans' mouths are smaller, which leads to smaller and less sharp canines, and there is no space between these teeth and the teeth at the front of the mouth.

You might be interested in
Given how the process of evolution appears to occur, how might concepts presented in this unit be used to help predict how any g
andrew-mc [135]
A general ballpark how one can predict the way how evolution will work in the future would be by thinking about the requirement of a certain area or environment and which changes would be necessary and relevant for any organism to thrive with its new changes. 

This could help people speeden up this process by enabling organisms to develop such traits faster, as well as ourselves. 
7 0
3 years ago
A property of water that results from the cohesion of water molecules at the surface of a body of water and that creates a sort
alexira [117]
It is called surface tension
8 0
3 years ago
Tectonic plates are pieces of the ________ that float on the more semi-solid ________ below.
Nastasia [14]
Fill in the first blank with lithosphere and the second blank with asthenosphere to make the sentence true.
6 0
3 years ago
You have red hair<br><br> Jeans<br> Or<br> Genes??
Artemon [7]
The answer is genes and not jeans.  

3 0
2 years ago
Read 2 more answers
If the concentration of water in the air surrounding a plant is less than the concentration of water inside the plants vacuoles
RUDIKE [14]

Answer:

<em>The water will diffuse into the air.</em>

Explanation:

Diffusion can be described as a process through which molecules travel from an area of higher concentration to an area of lower concentration along the concentration gradient. Such processes do not require energy. As the concentration of water is less in the air surrounding the cell as compared to the inside of the cell hence, the water molecules will move out of the vacuole and into the air by the process of diffusion.

3 0
3 years ago
Other questions:
  • Mutagens are chemical or physical agents that can alter the structure or sequence of DNA, causing mutations. Which of these is a
    7·2 answers
  • What would happen if decomposition did not occur?
    5·1 answer
  • A protective tissue that also secretes is ______________________ tissue.
    14·1 answer
  • active transport and facilitated diffusion are two types of cellular transport which statement is true of both
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Sam had a disease that weakened his heart so it could not pump properly. This heart problem
    14·1 answer
  • Explain why there is such a large difference between the amount of protein
    5·1 answer
  • Please help lolololol
    12·2 answers
  • PlsHelp!!!!!!!!!!!!!!!!!!!!!!!!!
    11·2 answers
  • What happens to a limestone over time
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!