1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka21 [38]
2 years ago
5

The nucleus is similar to the?A. Kidney B. LungsC. Heart D. Brain​

Biology
2 answers:
ser-zykov [4K]2 years ago
8 0

Answer:

d

Explanation:

Vlada [557]2 years ago
4 0

D is the correct answer bc they are both very similar

You might be interested in
Please answer :D
lozanna [386]
It should be igneous rock if that's an answer
3 0
3 years ago
Read 2 more answers
Identify which organisms can be infected by viruses. Choose one or more: A. Protists B. Bacteria C. Animals D. Plants E. Fungi F
svlad2 [7]

Answer:A. Protists B. Bacteria C. Animals D. Plants E. Fungi F. Archaea

Explanation:viruses are small non-living particles that contains hereditary materials.viruses attack cells of other organisms such as plants , bacteria ,archaea etc.

Viruses are acellular and contains either DNA or RNA.they cannot synthesis protein as they lack ribosomes ,so they use the ribosomes of the cell they have invaded to synthesize they proteins they need.

A virus usually has a central core surrounded by an outer protein coat called capsid.

Viruses can reproduce only within the living host cells and they are specific to the type of cells they attack.they attack plants through insect vectors or through openings on the plants.

Viruses can affect bacteria by injecting their nucleic acids through the cell wall and into the bacteria cell.such viruses are called bacteriophages.

6 0
3 years ago
Anabolic steroids are hormones that affect muscle growth. Many athletes 2 points
pav-90 [236]

Answer:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

Explanation:

It's true that anabolic steroids used by some bodybuilders and athletes contain testosterone or chemicals that act like testosterone. The difference is that doses used in testosterone replacement only achieve physiologic (natural) levels of hormone in the blood.

3 0
2 years ago
In the fall, leaves often turn orange, yellow, or red. How would you explain this phenomenon based on the results of this invest
inna [77]
The chlorophyll breaks down making the green disappear and the orange yellow or red become visible
3 0
3 years ago
Which statement correctly answers whether the question of alien life on this moon is scientific?
Jet001 [13]

Answer:

I think there is no life in tbe universe accept the earth.

Explanation:

6 0
3 years ago
Other questions:
  • Which photoreceptor cells respond to the longest wavelengths of light, ranging from approximately 500-700 nm?
    8·1 answer
  • The therapeutic effect of insulin in treating type 1 diabetes mellitus is based on which physiologic action
    5·1 answer
  • PLEASE ANSWER ONLY IF YOUR ANSWER IS FOR SURE!!!
    12·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • This is the class of animals that possess two pairs of antennae, an exoskeleton, and appendages with two branches.
    6·1 answer
  • What is an example of creatine phosphate?
    15·1 answer
  • Which of these is true of how plants use pollen to reproduce? (
    5·2 answers
  • Why is active transport needed to take mineral ions into the cytoplasm of the root hair cell?
    9·1 answer
  • A(n)<br> is a group of organisms that can mate and produce offspring that can mate.
    11·1 answer
  • Energy Pyramids represent the food chain energy and population sizes. Which statement is NOT true.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!