1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ede4ka [16]
3 years ago
14

Classify the quadrilateral using the name that best describes it.​

Biology
2 answers:
Firlakuza [10]3 years ago
6 0
Parallelogram you can see all the sides are “parallel” with lines marking it
jek_recluse [69]3 years ago
3 0

Answer: Parallelogram

Explanation: The four shapes that meet the requirements of a parallelogram are square, rectangle, rhombus, and rhomboid.

You might be interested in
What is a shadow? Explain by giving an example.​
likoan [24]
A shadow is a surface light cannot touch or reflect off of. Usually shadows appear when the main object is covering a light source. For example, lunar eclipses. Lunar eclipses cause a shadow over Earth because they block the main light source, The Sun from our point of view, casting a giant shadow over Earth.
3 0
3 years ago
Graphical representation of vectors involves​
horrorfan [7]
“20.2 Graphical representation of vectors (ESAGK)
Vectors are drawn as arrows. An arrow has both a magnitude (how long it is) and a direction (the direction in which it points). The starting point of a vector is known as the tail and the end point is known as the head.”
7 0
3 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
the distance between jupiter and the sun is 5.2 au whats the diffrence in millions of kilometers? one au is about 150 million ki
Mrrafil [7]
I believe it would be 780 million km. 

5.2 AU times 150 million km.

hope this helps
3 0
3 years ago
Read 2 more answers
Does Hyman's team have the ability to do this same procedure with other unidentified soldiers and if so, what would they need to
castortr0y [4]

Answer: Yes, they would either need a blood relative to take DNA samples from or something the deceased had before their death such as a baby tooth or hair.

5 0
3 years ago
Other questions:
  • Analysis of the second swab has confirmed that the causative organism is Streptococcus pyogenes, a gram-positive organism. Imagi
    7·1 answer
  • One of these four factors are incorrect in blood pressure? the heart, fluid pressure, turgor pressure, constricting of artery wa
    14·1 answer
  • What transports food made in the leaves to growing parts of the plant
    5·1 answer
  • a scientist isolates a number of non photosynthetic prokaryotes which structure would be found in theses cells​
    13·1 answer
  • Unicellular organisms would most likely have _____.
    8·1 answer
  • Which of the following best describe(s) the function of the 5' mRNA cap?
    7·1 answer
  • Eleanor is testing how temperature affects the hatching of chicken eggs. She has three groups of eggs, one each at 25°C (77°F),
    12·1 answer
  • A geologist is examining a new sample of rock. She is trying to categorize it based on its physical properties. Which of the fol
    10·2 answers
  • List and describe the 5 characteristics found in all living things; be able to identify various structures or processes as repre
    13·1 answer
  • Does anyone know the answer?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!