1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sidana [21]
3 years ago
13

7.Cells of a particular organism are dying at an incredible rate. Under a microscope, doctors are able to determine that the cel

ls
are swelling up with waste and bursting. What must be true of the cells?
O A. They are not synthesizing needed proteins.
B. The cell membrane has become completely permeable.
O C. They are no longer able to produce ATP molecules.
D. They are unable to perform exocytosis.
Biology
1 answer:
m_a_m_a [10]3 years ago
3 0

Answer:

The cells specialization is what give the cell the ability to survive amongst other cells, without it the cell would not be able to survive. This is a cells means of survival.

Explanation:

none

You might be interested in
A scientist studying Florida panthers makes many observations of a population over the course of several years. What is the scie
Afina-wow [57]

By studying the population over an extended period of time, scientists can discover the change in number of population and its growth.

Florida panther population is listed as endangered, but it is estimated that the number is recovering. The population had grown from about 25 adults in 1995 to roughly 100 in 2010. The updated estimates from the 2017. calculated the number between 120 – 230 panthers which is still not a sustainable population size.


4 0
4 years ago
The __________ lobe contains the primary sensory cortex, which controls sensations such as touch or pressure
Mama L [17]
The parietal lobe contains the primary sensory cortex, which controls sensations such as touch or pressure.
7 0
4 years ago
Which of these organelles is absent in a prokaryotic cell? ribosome nuclear membrane plasma membrane
aleksley [76]
<span> Some of the important features of a prokaryotic cell is that it contains a plasma membrane, ribosomes, and genetic material (DNA) that is not bound by a membrane. Therefore, prokaryotic cells lack a nuclear membrane. </span>
4 0
3 years ago
Read 2 more answers
Which statement explains why earthquakes tend to be deeper near subduction zones?
ICE Princess25 [194]

Answer:

Option C, At a subduction zone, oceanic crust is forced deep into the Earth.

Explanation:

At sub-duction zone, the dense oceanic plates coincides with the less dense continental plates and thus sink below the continental plates. Sometimes these oceanic plates being dense, sink to greater depth with in the earth’s mantle. The sub-duction zone causes  earth quakes of high intensity when oceanic crust penetrates to greater depths of earth crust as they tend to change the rheology of the earths’ mantle and also causes bending of plates

Hence, option C is correct

5 0
3 years ago
How is the fossil record evidence for evolution and how have organisms changed overtime?
Mashutka [201]

Answer:

Fossils are important evidence for evolution because they show that life on earth was once different from life found on earth today paleontologists can determine the age of fossils using methods like radiometric dating and categorize them to determine the evolutionary relationships between organisms.

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What does Eukaryopolis mean?
    13·2 answers
  • Explain the meaning of armada and protestantism by using both terms in a sentence.
    12·1 answer
  • 2 examples of gene flow
    7·1 answer
  • Which technique is used to create billions of copies of dna in a short amount of time?
    6·1 answer
  • In Stage 1 of his lab, Gunther adds 20 mg of solute into a solution. He stirs it and it completely dissolves. In Stage 2, he add
    12·2 answers
  • Which description of early Native Americans is most accurate?
    12·2 answers
  • How does petrification link to how the oldest fossils are found in the lowest rock
    9·1 answer
  • What is the role of mRNA in the process of protein synthesis?
    13·1 answer
  • This is the gas produced as a product of photosynthesis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!