1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
2 years ago
8

What can our nerves respond to? ​

Biology
1 answer:
OverLord2011 [107]2 years ago
4 0

They can respond to external stimuli

You might be interested in
Humans, and other organisms that reproduce through sexual means, obtain approximately half of their DNA sequence from the father
Lemur [1.5K]
Is the letter D because your having half of their DNA. That's why your mother is contributing the Y chromosome and your father is contributing the X chromosome
7 0
3 years ago
Read 2 more answers
Which of these is not a subatomic particle? proton ion neutron electron
Greeley [361]
I think protonion is a subatimic particle
3 0
2 years ago
Mohammed wishes to travel to South America in his yacht. Which knowledge of the oceans will help Mohammed navigate?
tatyana61 [14]
Ocean currents trust me
8 0
3 years ago
Why do cells need to replicate their DNA?
Vesnalui [34]

Answer:

Replication is an essential process because, whenever a cell divides, the two new daughter cells must contain the same genetic information, or DNA, as the parent cell. ... Once the DNA in a cell is replicated, the cell can divide into two cells, each of which has an identical copy of the original DNA.

Explanation:

6 0
2 years ago
Many polyploid plants, such as the bananas shown here, are grown commercially because they are often larger and healthier than n
kkurt [141]
Its <span>B) genetic mutation.</span>
8 0
3 years ago
Other questions:
  • The sequence of depositional units at a site is referred to as the siteʹs __________.
    13·1 answer
  • A problem that frustrates attempts to organize the entire living world for study: we don't know how many separate __________ of
    9·1 answer
  • What are some examples of fungi
    15·1 answer
  • Give an example of how you could determine whether or not a trait was displaying incomplete dominance. What would you do? What w
    15·1 answer
  • Explain why there are usually several types of pigments in the chlorophyll.
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • The P plants (the parental generation) that Mendel used in his experiments were all homozygous for
    13·1 answer
  • HELP ASAP!!
    12·1 answer
  • Which of the following is true about viruses?
    13·2 answers
  • What is herd immunity, and why are vaccines important for achieving herd immunity?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!