Answer: infrasound
Explanation:
The infrasound is called as the low frequency sound. The frequency of these sounds is less than 20 Hz. The sound waves of the infrasound cannot be perceived by the humans as human ear are less sensitive to the low frequency. The infrasound can be produced in extreme weather conditions, earthquakes, meteor impacts, explosive detonation, collision of oceanic waves, waves on beach, and sound produced by the air conditioner.
Water vapor is the basic ingredient
There are three major forms of fossil fuels and these are coal, oil and natural gas. All three were formed many millions of years ago before the time of dinosaurs.
Plants and trees died and sank to the bottom of swamps which filled the land. The dead matter formed layers of a spongy material called peat. Over time the peat was covered by sand, clay and other minerals which turned into sedimentary rock.
As the layers of rock piled up, their weight squeezed the peat until water came out of it and it eventually turned into coal, oil and natural gas.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
