1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
13

What are the two sensory functions of ears?​

Biology
1 answer:
Nat2105 [25]3 years ago
5 0

Answer:

obviously listening and hearing

You might be interested in
State two of Newton's three laws.
Viefleur [7K]

Answer:

<u>Newton's three laws of motion may be stated as follows</u>:

1) Every object in a state of uniform motion will remain in that state of motion unless an external force acts on it.

2) Force equals mass times acceleration

3) For every action there is an equal and opposite reaction.

Happy to help

Pls mark as Brainliest

4 0
3 years ago
Read 2 more answers
I need help pleaseeeeeee
sleet_krkn [62]

Answer:

The answer for writing 421,700 km in scientific notation is A

6 0
3 years ago
Read 2 more answers
Describe the functions of bone. In what ways does bone<br> participate in homeostasis?
densk [106]

Answer:

Functions of the bones in the human body:

Support, protection, movement, mineral homeostasis

Explanation:

- Support: the bones provide a rigid support frame for muscles and soft tissues.

- Protection: the bones form several cavities that protect the internal organs from possible trauma. For example, the skull protects the brain against blows, and the rib cage, formed by ribs and sternum protects the lungs and heart.

- Movement: thanks to the muscles that are inserted into the bones through the tendons and their synchronized contraction, movement occurs.

- Mineral homeostasis: the bone tissue stores a series of minerals, especially calcium and phosphorus, necessary for muscle contraction and many other functions. When necessary, the bone releases these minerals in the blood that distributes them to other parts of the body.

8 0
3 years ago
A plant is living along the shore of a deep, large, and cold body of fresh water. The top of the body of water is full of life a
quester [9]

Answer:

A lake I would assume because lakes have a depth to where you cannot see so it’s deep and dark down in lakes!

7 0
3 years ago
Read 2 more answers
Is melanin a gene or protein?
Oksanka [162]

Answer:

Protein

Explanation:

Melanin is a protein that affects the color of our hair, skin, or animals fur.


I hope it helps! Have a great day!

Pan~

5 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following is most dense? asthenosphere, continental, crust , core , mantle, or oceanic crust
    6·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • By the end of the second trimester of pregnancy, A. all a human's body parts are fully developed. B. a human's brain has not yet
    15·1 answer
  • Help ASAP!!!PLZ Which of the following could result from an algal bloom in a river?
    10·2 answers
  • Why are sex-linked disorders more common in males than in females?
    12·1 answer
  • Why is there rain<br> in the sky
    11·1 answer
  • __________ cells contain a cell wall that is not found in __________ cells.
    15·1 answer
  • Eventually the weight will stop moving. Why? Where does the energy go?
    9·1 answer
  • What are the propertirs of Radon?
    10·1 answer
  • What is the name of the sugar that makes up DNA?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!