1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pishuonlain [190]
3 years ago
10

Which two sentences best explain what happens to the energy snails get fromo the plants they eat?

Biology
2 answers:
Mars2501 [29]3 years ago
8 0

Answer:

I think it's B and D.

Explanation:

timurjin [86]3 years ago
5 0

Answer:

Explanation:

D and c

You might be interested in
What is the scientific name for a pine cone?
lara31 [8.8K]
Pinus :)













this made me laugh
6 0
3 years ago
Read 2 more answers
What type of environment do sedimentary rocks form in? Where do metamorphic rocks form? Keep in mind the rocks at the Great Unco
UkoKoshka [18]

there is no answer so stop cheating okay or i will tell your parent



7 0
3 years ago
Which diagram shows the pathway of energy through an ecosystem?
Iteru [2.4K]
Question 1:
The correct answer should be the one that shows the producer first, (->) followed by the herbivore, (->) with the carnivore last.
Producers are organisms that harvest their own 'food' using things like the sunlight and water. Examples of producers are grass and other vegetation.

Producer
The herbivore, or an organism that consumes only vegetation and/or algae, consumes the producer.

Producer ⇒ Herbivore
The carnivore consumes meat, or other animals such as the herbivore. It's the last. 

Producer ⇒ Herbivore ⇒ Carnivore
Therefore the answer is B. 
____________________________________________________________
Question 2:
 I'm pretty sure that succession as well as regrowth after volcanic eruption (Just look at Mount St. Helens. After 30-35 years after the eruption, nature is still recovering) happens over time/slowly. I would say global warming [C](?) would be the answer. 
5 0
3 years ago
Read 2 more answers
What percent of one’s daily caloric intake should come from carbohydrates?
NISA [10]
This answer will vary a lot, depending on who you will ask. If you're asking proponents of the LCHF (low carbs, high fat) diet, they would say you should reduce your intake of carbohydrates down to around 10 to 20 percent, making either A or C your desired answer.

If you would ask people who propose the current nutritional guidelines as the best way of eating, the amount of caloric intake that should come from carbs according to them would be more in the range of around 40%, making B the correct answer.

There isn't really any clear cut answer here. 
6 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Other questions:
  • Where are sex-linked conditions most often carried?
    15·2 answers
  • Why is energy required for life
    11·2 answers
  • 15) Spinal interneurons prevent muscle antagonists from interfering with an intended movement by A) the process of reciprocal in
    14·1 answer
  • What is always true of scientific practices a. They prove a hypothesis to be correct b. They involve steps performed in the same
    5·1 answer
  • Place the filling in order for smallest to largest :chromatin,chromosomes ,DNA ,nucleoside ,sister chromatid
    8·1 answer
  • What kind of interaction do you think the prairie dogs have with the rattlesnakes?
    9·2 answers
  • When does the segregation of alleles occur?
    14·1 answer
  • What would happen to Earth's climate if we had no moon, and why?
    13·1 answer
  • In cells, the production of proteins is handled by the ribosomes and endoplasmic reticulum, while the processing and packaging o
    10·1 answer
  • Why would very wet soil be dangerous to plants
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!