1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kirill [66]
3 years ago
9

Examine the photographs of 16 species of anole lizards and sort them into as many groups as you want according to how they appea

r in the photographs. Explain how you grouped the lizards and your rationale for the various groupings. If you picked a body feature, speculate about the advantages or disadvantages of such a body feature in the environment that species occupies.
Biology
1 answer:
n200080 [17]3 years ago
8 0

Answer:

On the basis of physical appearance.

Explanation:

We grouped the lizards into various groups on the basis of similarities and differences in the body structure, appearance and colour etc. The legs of anole lizards are small legs with pads on their feet for gripping surfaces which give them the advantage to climb up the trees while on the other hand, these small legs can't help in the survival on the land because they can't run too fast from their predators with these short legs so these legs has benefit in climbing the tree but disadvantage in running on the land.

You might be interested in
A particular cell has half as much dna as some of the other cells in a mitotically active tissue. the cell in question is most l
Katena32 [7]
 your answer is a. G1
5 0
3 years ago
A(n) ________ acid is an acid that can leave solution and enter the atmosphere.
mrs_skeptik [129]
A volatile acid can leave the solution and enter the atmosphere
8 0
3 years ago
Check Your Understanding<br> Question: What is an adaptation?
AleksandrR [38]

Answer:

an adaptation can be defined as an inherited trait which confers an evolutionary advantage to the organism in a certain environment

Explanation:

An adaptation, also known as an evolutionary adaptation, can be defined as any physiological and/or morphological inherited trait related to the improved evolutionary fitness of one organism in a particular environment. An adaptation improves the chances of survival and reproduction in a certain environment, thereby organisms carrying the adaptation have more chances to produce descendants and pass their genes to the next generation. Some classical examples of evolutionary adaptations include the long necks of giraffes that help them to eat leaves at the top of trees, light bones of flying birds, etc.

8 0
3 years ago
Although there is scientific evidence and many scientific theories about the origin of the universe, how it all happened remains
MrMuchimi
True - The Big Bang Theory is the most popular THEORY out their. Meaning it is NOT a fact
4 0
3 years ago
Give three examples of commons, and then list some resources available from each. ​
andreev551 [17]

Answer:

air, water, and a habitable earth

Explanation:

the resources are oxygen from air, fish from water, and fruits, vegetables, meat, and herbs that can help with health.

4 0
3 years ago
Other questions:
  • You perform an experiment in which you take 16 pots of strawberry plants and give half of them 1 gm of ammonium nitrate per lite
    7·1 answer
  • The presence of many C-C and C-H bonds causes fats to be ... The presence of many C-C and C-H bonds causes fats to be ... (a) ri
    10·1 answer
  • A chloroplast contains green pigment called
    8·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • The Karez well system _______.
    8·2 answers
  • How does a Calorie on a food label relate to a calorie that is produced in cellular respiration?
    12·1 answer
  • The processes involved with reproduction and nurturing a growing zygote
    15·1 answer
  • Besides reducing biodiversity what are the characteristics of an ecosystem that might change if the conditions of the ecosystem
    5·1 answer
  • How does the mitochondria produce energy for the cell worksheet answers
    11·1 answer
  • Pls help ill give brainlliest and 5 stars
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!