1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
m_a_m_a [10]
3 years ago
13

Do you feel that human activity can lead to speciation and eventually evolution? Explain why or why not.​

Biology
1 answer:
Angelina_Jolie [31]3 years ago
6 0

Answer:

Yes

Explanation:

I feel that over time people might be prone to do certain things over other things. Over time if we keep getting lazier and lazier and more and more addicted to our phones and electronics, we might just cut everything else out in the world. I would consider that evolution because people are evolving over time to like certain things over other things. People might neglect things like Shelter, Food, and a decent relationship to be entertained. People also might take other peoples examples like doing challenges are influencing people to make decisions for short lived fame, and all of this is because of human evolution turning into lazy people or wanting fame.

You might be interested in
Suppose you conduct an investigation to find out the types of soil in your neighborhood why would it be helpful to test soil at
topjm [15]

This is because a sample is supposed to ideally represent the whole population from which it was taken. Taking samples from different location within the population ensures that they are no bias in the sample. Each part of the population should be well represented in the sample so that the conclusions drawn from the sample represent the properties of the whole population.

7 0
4 years ago
Aaron has blood type O. Can either of his parents have blood type AB? Explain your answer.
Brums [2.3K]
Surely if he has blood type O, one parent has to have type O also
6 0
4 years ago
Why was Darwin’s Theory of Evolution accepted when others were not?
Alinara [238K]
Darwins theory was accepted because his seemed the most realistic along with the most evidence and logical proof.
5 0
3 years ago
What is the chemical indicator for sugar and what is a positive result look like
frez [133]

Answer:

Benedict's solution is the indicator for sugar which is made up from copper sulfate and sodium hydroxide

the positive result is the observation of brick-red precipitate.

3 0
4 years ago
System that transports nutrients and wastes and plays a role in the immune response
VLD [36.1K]
The circulatory system
5 0
4 years ago
Other questions:
  • Compare and contrast properties of sister chromatids and homologous chromosomes.
    13·2 answers
  • A single cell begins meiosis. how many cells will there be after meiosis i, to begin meiosis ii
    13·1 answer
  • Most organisms can be divided into two categories - prokaryotes and eukaryotes. What is the main difference between these two ca
    12·2 answers
  • in which digestive system organ will you find the enzymes responsible for breaking down disaccharides into monosaccharides and d
    9·1 answer
  • I need help I’m not sure what’s the right answer!!
    9·2 answers
  • A scientist shines ultraviolet light on a colony of blue colored bacteria. She then places colonies of the bacteria in separate
    6·2 answers
  • (01.03 LC) A student is trying to calculate the density of a can. He already knows the mass, but he needs determine the volume a
    6·1 answer
  • What is the complementary DNA of TACCGGATGCCAGATCAAATC?
    10·1 answer
  • PLSSSSS HELP<br><br> What are the three ways that minerals can form?
    12·2 answers
  • [SELECT ALL THAT APPLY.]
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!