1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kitty [74]
3 years ago
7

Can the epidermis bleed?

Biology
1 answer:
VLD [36.1K]3 years ago
6 0

Answer: Layers of the Epidermis. The epidermis is the outermost layer of our skin. It is the layer we see with our eyes. It contains no blood supply of its own—which is why you can shave your skin and not cause any bleeding despite losing many cells in the process.

You might be interested in
Pls help timed test will give brainly to most helpful answer
Darina [25.2K]

both sudden slip on a fault

7 0
3 years ago
Read 2 more answers
Lead enters the atmosphere as a particulate pollutant. this is a problem because it ________. select one:
cluponka [151]
C causes central nervous system damage to humans
5 0
3 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Case 12-2 Mother Goose Computing, Inc. provides computational biology consulting services. They are currently updating several o
Reil [10]

Answer:

Direct.

Explanation:

An information system can be defined as a set of components or computer systems, which is used to collect, store, and process data, as well as dissemination of information, knowledge, and distribution of digital products.

Generally, it is an integral part of human life because individuals, organizations, and institutions rely on information systems in order to perform their duties, functions or tasks and to manage their operations effectively. For example, all organizations make use of information systems for supply chain management, process financial accounts, manage their workforce, and as a marketing channels to reach their customers or potential customers.

Additionally, an information system comprises of five (5) main components;

1. Hardware.

2. Software.

3. Database.

4. Human resources.

5. Telecommunications.

Hence, an information system interacts with the overall system by receiving data in its raw forms and information in a usable format.

In this scenario, Mother Goose Computing, Inc. are currently updating several of their systems. For the genomics division, it's planning to replace the old system by the new one all at once. Thus, this is called a direct conversion.

Direct conversion can be defined as a process which typically involves the establishment and implementation of a new system followed by an immediate discontinuation of the old system all at once. Thus, on a particular date and time, the old system would be discontinued while the new system is immediately adopted for use in the particular organization.

8 0
3 years ago
In order to find the density of an object, Maria is trying to measure its volume. However, the object does not fit in the tool s
mr Goodwill [35]
I would say C cause it sounds right
8 0
3 years ago
Other questions:
  • An________ reveals the electrical activity of the brain by producing a record of brain waves. a _________ reveals activity in va
    9·1 answer
  • Meiosis is the basis for
    7·1 answer
  • A hormone attaches to a target cell at a receptor protein. What do you know about this hormone?
    6·1 answer
  • Why is the dominant allele called dominant.
    13·1 answer
  • Linda and Ben request prenatal genetic testing to determine if their unborn child has Down syndrome. Which of the following tool
    6·1 answer
  • A limerick on soil erosion five lines can someone help me.
    15·1 answer
  • PLEASE HELP! Describe what you know about enzymes that explains your evidence and your claim.
    12·1 answer
  • Study island 7th grade
    11·2 answers
  • Meiosis and Mutations are both sources of/for:
    8·1 answer
  • 8.<br> Which one do you think, more often, results in an offspring not surviving? Explain
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!