1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Monica [59]
3 years ago
11

Its biology, help please :)​

Biology
1 answer:
Anestetic [448]3 years ago
5 0
For question 3, it would not leak through the whole sandwich because the cell membrane is thick
You might be interested in
From a single fertilized ovum undergoing a series of rapid cell divisions, a human infant develops. The embryonic cells become s
weeeeeb [17]

Answer:

Answer is C

Explanation:

Each cell has an identical copy of DNA with enzymes controlling the expression of specific genes leading to a variety of cells

3 0
3 years ago
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Sex-linked recessive disorders are most often passed from mother to sons
egoroff_w [7]
I believe that this is true
7 0
3 years ago
Construct a scientific explanation based on evidence for the role of photosynthesis in the cycling of matter and flow of energy
Artyom0805 [142]
Phi jhfhgfhfufiitjtbt thtitutuitbr Toronto tmltbt ntot t Thorvaldsen t
6 0
3 years ago
Which of the following is a species? <br> A. Giant Pandas<br> B. Horses<br> C. Humans<br> D. Rabbits
sasho [114]
I would guess giant pandas because they aren't referring to a regular panda. giant pandas are a type of panda that live in Asia. then there are other types too. my second guess would be humans just because there are no other "species" or type of human but the pure form of human.
3 0
3 years ago
Read 2 more answers
Other questions:
  • "__________" is a homemade alcohol produced during the prohibition.
    8·1 answer
  • In some proteins, the side chain of serine appears to undergo ionization. explain why ionization would be facilitated by the pre
    6·1 answer
  • Food moves through the digestive tract by peristalsis, which is produced by wavelike contractions of ______ muscles answers
    11·2 answers
  • Summarize the bonding properties of carbon
    13·1 answer
  • 5. How does mitosis help a planarian clone itself?
    9·1 answer
  • Use the Word bank below to fill in the blanks correctly
    10·1 answer
  • The cytoplasmic extensions that, together with the cell body, provide the main receptive surfaces for neurons are the
    5·1 answer
  • Chloroplasts and mitochondria have something in common that supports the theory of endosymbiosis. What is it?
    12·1 answer
  • When the head is tilted, what are the structures the signal passes through on its way to becoming a fully processed neural signa
    8·1 answer
  • In cellular reproduction, ___ ALWAYS occurs in 5’ to 3’ direction
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!