1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alchen [17]
3 years ago
5

20 POINTS!! SELECT ALL CORRECT ANSWERS!!

Biology
2 answers:
Kay [80]3 years ago
6 0
1. the westerlies goes from west to east
2.gyres are made of winds
3. That is true
4. The trade winds are point to west.
5. Topography determine how high the mountain are.(fewtures)
6. The thermohaline begins in the Earth's polar regions. When ocean water in these areas gets very cold, sea ice forms. The surrounding seawater gets saltier, increases in density and sinks. Winds drive ocean currents in the upper 100 meters of the ocean's surface.
stira [4]3 years ago
4 0

Answer:

xecr tbyununybt y 7nbytvthhbbhd r f

You might be interested in
When an apple is cut, oxygen comes in contact with the fruit’s inner tissue and browning occurs. One particular enzyme in the ap
Oksanka [162]

Answer: The cut slices should be refrigerated to slow the reaction. Also, you can coat them with lemon or pineapple juice.

Explanation: The acids in these juices slow the reaction and the antioxidants inhibit it.

6 0
3 years ago
WILL MARK BRAINLIEST!!
vladimir1956 [14]

Answer:

D

Explanation:

8 0
3 years ago
Read 2 more answers
What kind of tide does the observer experience when he is between tidal bulges?
Aneli [31]
High tide. That is where the tidal bulge is.
7 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which is an example of a vestigial structure?
Karolina [17]
I think it’s a forelimb of a whale
7 0
3 years ago
Other questions:
  • Suppose you are unable to remember any of the events or episodes of your life. this may be because of damage to your ____.
    7·2 answers
  • Which statement is an example of mutualism? Bees sting other organisms when they sense danger. Bees pollinate flowers while obta
    11·2 answers
  • Scientists study the evolutionary relationships of species to better understand the history of life on Earth. Describe two metho
    11·1 answer
  • What could happen if there was a mistake durning prophase,metaphase,anaphase and telophase?
    6·2 answers
  • A particular diploid plant species has 48 chromosomes, or two sets. A mutation occurs and gametes with 48 chromosomes are produc
    8·1 answer
  • What does it mean if an experiment exhibits reproducibility?
    12·2 answers
  • There are several different types of symbiotic relationships. In this case, a tick attaches to an animal and feeds on its blood.
    13·2 answers
  • The ozone layer in the stratosphere protects Earth from the sun's ultraviolet radiation. Where does the ozone come from?
    5·1 answer
  • Earth’s surface features slowly change over time. For example, sharp, jagged mountain ranges become lower and more rounded over
    11·1 answer
  • 2. Which of the following states of water are described in the passage?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!