1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
3 years ago
15

If a gamete contains 24 chromosomes, how many chromosomes would the somatic cells contain?

Biology
1 answer:
Alex787 [66]3 years ago
3 0

Answer:

46 chromosomes are present in somatic cell

You might be interested in
Which characteristics describe this rock sample? Check all that apply. large crystals coarse texture evidence of rapid cooling f
Lena [83]

Answer:

a, b, e

Explanation:

You just have to pay attention to what you see

3 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Describing the Big Bang Theory
irina [24]

Answer:

QWERTY

Explanation:

7 0
3 years ago
This is a wetland food web. When the organisms you see here die, they become food for ____________, which help recycle matter ba
Lady bird [3.3K]

B decomposers

Explanation:

4 0
3 years ago
Read 2 more answers
What motion is responsible for producing a "day" upon the earth?
baherus [9]
The rotating movement along the earth's axis
3 0
3 years ago
Other questions:
  • Using the terms DNA, trait, code, pattern, gene, describe why each organism is unique
    15·1 answer
  • Which of the following is true about skin bones muscles the heart intestines
    7·1 answer
  • After reading the paragraph below, answer the question that follows
    13·1 answer
  • Briana is listing some pros and cons of recycling bottles. What can she list in the “Con” column? Pro Con Uses less energy to ma
    11·1 answer
  • Good observations are not critical to scientific investigations.<br><br> True<br><br> False
    6·1 answer
  • compare the sex cells produced by mieosis to the parent cell. Why is the difference between the sex cells and parent cell import
    15·1 answer
  • What are the nuclear particles assumed to hold the nucleons together
    15·1 answer
  • What is the definition of a organelle found within a plant cells that contain chlorophyll and carry out photosynthesis
    5·1 answer
  • Select the correct answer from each drop-down menu. Alma is walking in a park. Suddenly, a wild dog charges toward her. Alma is
    7·1 answer
  • Does anyone know this answer? please help!
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!