1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alukav5142 [94]
3 years ago
11

AAAAAUGACCAAAGUGGAGUAAUGGUAACCC please type first 3 letters of each amino acid separated by a dash.

Biology
1 answer:
alexandr1967 [171]3 years ago
8 0

Answer:

what?

Explanation:

You might be interested in
What information do fossils provide about the history of organisms on Earth
yanalaym [24]
The fossil record provides evidence of Earth’s changes over time. It's a record keeper of the Earth'd changes over time.
3 0
3 years ago
Which additional natural resource would be MOST IMPORTANT to a society wanting to become industrialized? a) dry land b) strong w
RideAnS [48]

Answer:

Rare materials

Explanation:

These raw materials are to be used for proper development and industrialization of this society

8 0
4 years ago
Read 2 more answers
Need answer quick please thanks
Andre45 [30]

Answer:

Aa would be ur answer:)))

8 0
3 years ago
Can you please help me
SCORPION-xisa [38]
1. 25% which is bb
2. All living things are made of cells
3. Grams, mass

Hope that helps.
4 0
3 years ago
A receptor can directly open a channel and thereby exert a(n) ____ effect, or it can produce slower but longer ____ effects.​
svlad2 [7]

Answer: ​ionotropic; metabotropic

Explanation:

A receptor can directly open the channel and exerts an ionotropic effect. The ionotropic effect takes place by the help of ionotropic receptors. These receptors are membrane bound receptor proteins which responds by the bonding of the ligand.

Due to ligand binding the channel opens and allows the movement of ions into the cells which helps in either increasing or decreasing the action potential.

The receptors can also bind to the ligand and produce metabotropic effect which means by the second messenger.

6 0
3 years ago
Other questions:
  • Which classes of wave is descriptive of sound? Longitudinal waves or Transverse waves?
    7·1 answer
  • What does it mean to say that double-stranded nucleic acids are<br> antiparallel?
    12·1 answer
  • Which of the following happened during the Precambrian Era?
    13·1 answer
  • Where is the energy in the products of photosynthesis?
    13·1 answer
  • Air is primarily composed of Nitrogen and oxygen gases. Which state of these gases can conduct electricity?
    13·2 answers
  • which of the following is a type of circulatory system open closed both a and b or none of the above
    8·1 answer
  • What type of region is the state of Kentucky?
    6·2 answers
  • How do classify species into taxa?
    7·2 answers
  • What would you expect to happen if a transfusion recipient had blood type o and a donor had blood type ab?
    6·1 answer
  • a potential cancer-causing gene coding for a protein with cell cycle control responsibilities is a(n) , and a gene coding for a
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!