1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
makkiz [27]
3 years ago
6

Which law provides for the cleanup of toxic waste site in the united states

Biology
2 answers:
TEA [102]3 years ago
8 0
Which law provides for the cleanup of toxic waste site in the united states A. soil and water conservation act.
stira [4]3 years ago
4 0

Answer:

The Correct Answer is B

Explanation:

You might be interested in
Describe how the integumentary system responds to differences in sunlight
Mama L [17]

The integumentary system (skin) reacts different on different sun intensity (different length exposure to sun).

For example, moderate exposure to the sunlight contributes to the production of melanin and vitamin D by the body. On the other hand, high exposure to sunlight can have negative health effects such as sunburn, which is an inflammatory response to DNA damage caused by UV radiation.  


5 0
3 years ago
PLZ HELP
Paraphin [41]

Answer:

homeostasis is in yourr endocrine system. its if your blood suger is too low or high. if its too high your cells will absorb glucose. if its too low, your cells will release glucose.

Explanation:

hope this helps luv! good luck!

7 0
3 years ago
Read 2 more answers
Describe how Schwann cells form the myelin sheath and the neurilemma.
-Dominant- [34]

Answer:

Schwann cells or neurilemma cells are the cells which form the myelin sheath around neuronal axons in the peripheral nervous system (PNS) only.

Neurilemma is the collective term used for cytoplasm and nuclei present around the myelin sheath which helps in the regeneration process of nerves.

A Schwann cell surrounds the axon, invaginate it and the plasmalemma of the Schwann cells joins and from a double membrane structure called mesaxon. This mesaxon starts wrapping the axon in spiral fashion and cytoplasm start condensing into the compact myelin sheath.

7 0
3 years ago
When a phosphate group is removed from an ATP molecule, energy is......................
Gnoma [55]

Answer:

Released.

Explanation:

The bonds between the phosphates in ATP are very high energy, meaning that the bonds really really want to break because phosphates don't like being so close to each other.  When the bonds do break, a ton of energy is released (think of it like a celebration that they aren't so close anymore).  

5 0
2 years ago
Social cognitive theory proposes that changing a behavior is a function of individual characteristics. True or False
sertanlavr [38]

Answer:

The answer is: False.

Explanation:

Social cognitive theory stands that portions of an individual's knowledge acquisition can be related to <em>observing others within the context of social interactions. </em>

When people observe a model performing a behaviour and the consequences of that behaviour, they remember the sequence of events and <em>use this information to guide subsequent behaviors</em>.

The theory says that people do not leatn new behaviours solely by trrying them and either succeding or failing, but upon the replication of the action of others.

I hope it works!

8 0
3 years ago
Other questions:
  • A dichotomous key for insects is given. To what order does an insect with two pairs of scaly wings belong?
    5·2 answers
  • What occurs when one cannot move certain parts of the body
    12·2 answers
  • Which of the following is not a result or consequence of rising average air temperatures on earth?
    14·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which process in respiration happens first
    12·2 answers
  • The molecule that serves as the major source of readily available fuel for neurons and blood cells is ________.
    10·1 answer
  • The term used to describe one of the possible forms of a character
    5·1 answer
  • The nucleotide sequence of a DNA codon is TAG. In an mRNA molecule transcribed from this DNA, the codon has the sequence _______
    14·1 answer
  • NO LINKS AS AN ANSWER
    14·2 answers
  • Which curve would most likely represent the behavior of the receptor once it has been activated by its signal molecule?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!