1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anestetic [448]
3 years ago
13

Which glaciers are mainly formed near a mountain?

Biology
2 answers:
Nitella [24]3 years ago
8 0
Continental glacier.
ValentinkaMS [17]3 years ago
3 0
Continental glaciers
You might be interested in
What is the correct order light must go through to be analyzed by the visual system?
NeTakaya

The light will enter they eye and it will be refracted as it passes through the cornea. It will then pass the pupil which is controlled by iris and will be further refracted by the lens. The cornea and lens together will form a compound lens in order to project images which are inverted into the retina.

7 0
4 years ago
A biologist observes that a species of stick insects on a remote island has three different color traits, almost equally distrib
nirvana33 [79]
C The dark green phenotype benefits the insects' survival, making them more likely to reproduce.
5 0
4 years ago
Read 2 more answers
It is important to understand that the wilcoxon matched-pairs test is based on the relative ranks of
egoroff_w [7]
Hi the answer is based on the ranks of the difference scores between the matched pairs.
3 0
3 years ago
Complete the following analogy. Chromosome is to tree as gene is to .
Serhud [2]
I think that Chromosome is to tree as gene is to Leaves? Is it a multiple choice because you should give options out of all characteristics of a tree.

6 0
3 years ago
There are five main factors of soil formation. State what these are and explain how each one contributes to soil profile develop
Alenkasestr [34]
The five main factors of soil formation are: Parent Material, Climate, Living Organisms, Landscape Position and Time. <span>
</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • How can humans protect the beach from erosion
    11·1 answer
  • What is an organelle used to store the materials needed by the cell. it's also used for storing waste?
    6·2 answers
  • Eli wants to reduce his impact on the environment. Which activity should Eli do to help the environment and his community?
    12·1 answer
  • Why do beaches reflect the composition of locally available materials ?
    6·1 answer
  • Which of the following is found in both prokaryotic and eukaryotic cells?
    11·1 answer
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Converting farmland to urban areas through urban development could lead to
    8·2 answers
  • Plz help this is past due
    6·2 answers
  • What are 3 ways convection currents affect the weather​
    6·1 answer
  • What factors led to the commercial extinction of northern cod? (site 1)
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!