1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
d1i1m1o1n [39]
3 years ago
6

What is unusual about Earth’s mantle being exposed?

Biology
1 answer:
cluponka [151]3 years ago
6 0

Answer:

There is no actual way that the mantle could be...'exposed' or 'seen'. But scientists have managed to find multiple ways to analyze the mantle and it's actual existence by using multiple devices. The mantle is basically a 2,900 kilometers (1,802 miles) thick blocks of rocks and minerals underneath the crust(or the surface of the earth) , and makes up a whopping 84% of Earth's total volume.

You might be interested in
What is substrate level phosphorylation and how many atp form in glycolysis by this?.
Liono4ka [1.6K]
Substrate level phosphorylation is the formation of ATP to ADP. Due to substrate level phosphorylation, glycolysis forms 4 ATP.
6 0
2 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
"the _____ controls the release of our body s stress hormone, cortisol."
zepelin [54]
The correct answer is HPA axis.

The Hypothalamic-Pituitary-Adrenal (HPA) axis is one of the most important neuroendocrine systems, which regulates the stress response and other functions such as the digestion, mood, emotions and the immune system.

The hypothalamus, when triggered by a possible stressor, releases two hormones; the vasopressin and the corticotropin-releasing hormone (CRH). CRH, in turn, triggers the release of the adrenocorticotropin hormone (ACTH) from the pituitary gland. As a result of the secretion of ACTH, cortisol is secreted by the adrenal cortex.

Cortisol is a steroid hormone, considered to be our body's stress hormone.
3 0
3 years ago
What is meant by the term asystole? Is this a medical emergency
matrenka [14]
Asystole is defined as a cardiac arrest rhythm in which there is no discernible electrical activity on the ECG monitor. Asystole is sometimes referred to as a “flat line.” Confirmation that a “flat line” is truly asystole is an important step in the ACLS protocol.
3 0
3 years ago
Is chemical reaction photosynthesis, celluar respiration or both?​
ankoles [38]

Answer:

chemical reaction is both photosynthetic and cellular respiration

7 0
3 years ago
Other questions:
  • When using the scientific method, what is the last thing a scientist must do before the conclusions can be considered trustworth
    8·1 answer
  • Need the answer quickly  
    7·1 answer
  • Proteins in a membrane are __________.
    7·2 answers
  • Jim made this incorrect diagram to represent the order in which four events took place on Earth.. . 1 primitive fish.. 2 primitv
    10·2 answers
  • Species A has a breeding call that is completely different from Species B. This difference in breeding call leads to
    9·1 answer
  • Why is a mutation in gamete worst than a mutation in a somatic cell
    15·1 answer
  • HOW TO<br> PROJECT: PUNNETT SQUARES<br> NEED HELP :(
    8·1 answer
  • What organelle is responsible for folding proteins in the cell
    8·2 answers
  • The smallest particle of an element is an atom?
    6·1 answer
  • Why is chlorophyll important in the process of photosynthesis?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!