Answer:
I disagree
Explanation:
The data doesn't give enough info, were the people who lived with smokers, smokers as well? or were they clean off nicotine. Also the data presents itself stating the fact that second hand smoke will defiantly cause Lung cancer when in reality (as the data shows with only 7.4%) only a small percentage is affected by the smoke.
Answer: knowing that the number of adenine will be always equal to the number of thymine.
Explanation:On the basis of base pairing rule, the purine bases bonds with the pyrimidine bases. This takes place as the configurations of pyrimidine and purine bases permit formation of hydrogen bonding between the two.
The base pairing rule suggests that the pairing of adenine takes place only with thymine and pairing of guanine takes place only with cytosine. Two hydrogen bonds are produced between an adenine and thymine base pair, while three hydrogen bonds are produced between a guanine and cytosine base pair.
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
In Indian cuisine, sometimes a papaya is added to make meat cook faster. Why does this method work?
A- Papaya helps increase the temperature of the meat, hastening the cooking process.
B-Papaya has the enzyme papain, which tenders the meat tissues, hastening the cooking process
<u>
C-Papaya has the enzyme papain, which increases the pH of the meat recipe, hastening the cooking process.</u>
<u>plz mark as brainliest</u>
