A group of organs hope you get a good grade
Answer:
The correct answer is - they both have highly folded membranes.
Explanation:
Organelles such as the endoplasmic reticulum, Golgi apparatus, and mitochondria have highly folded double membranes. This highly folded membrane provides the increased surface area in the organelle.
As the inner membrane of these organelles is the site for many chemical reactions the highly folded or layered membranes get more space for such reactions to occur due to increased surface area.
PH is a measure of how acidic/basic water is. the range goes from 0 to 14 with 7 being neutral. pH is really a measure of the relative amount of free hydrogen and hydroxyl ions in the water
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
C. camouflage, camouflage is when an animal is blending in with its surroundings.
