1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady_Fox [76]
2 years ago
7

4. Why would a cell need to have the option to make or not make protein

Biology
2 answers:
trasher [3.6K]2 years ago
5 0
If the protein is needed. The cell would make the protein using the DNA but if the protein is not needed there would be a gene regulation which would block the RNA polymerase to make mRNA so protein would not be created. So the protein is only made when it is required. Or else making it would be a waste of energy and resources.
Arte-miy333 [17]2 years ago
4 0

Answer:

Because it might it might not want to

You might be interested in
(04.01 LC) Which level of organization is formed from two or more different tissues that group together and perform a function?
Colt1911 [192]

The correct answer is the organ.  

The multicellular species are formed of various parts, which are required for survival. These parts are differentiated into the levels of the organization. There are five different levels, which are named as cells, tissue, organs, organ systems, and organisms.  

When two or more layers of tissue function together, they produce an organ. All the animals comprise vital organs, without which they cannot survive. These include the kidneys, liver, lungs, brain, and heart.  


8 0
3 years ago
Read 2 more answers
If a set of data is highly precise, what does this indicate about the accuracy of the data? It indicates that the data must have
lubasha [3.4K]
If a set of data is highly precise, it generally "indicates that the data must have a high level of accuracy" although there can be other crucial factors affecting the data as well.
6 0
2 years ago
Read 2 more answers
Why is matter important to cycles of nature?
user100 [1]
Without matter theyre is no nature
7 0
2 years ago
Read 2 more answers
A scientist studied a population of birds for 10 years. During that time, the population was never fewer than 30 birds and never
ahrayia [7]

Answer:

A particular population limiting factor or factors must have been removed

Explanation:

The population of the birds must have been kept between 30 and 50 individuals by population limiting factors such as the presence of predators within the community or competition for resources such as food or spaces.

For the population to shoot up to 90 all of a sudden, it may be that one or more of the population limiting factors has been removed from the population. <u>It could be that a major predator has been removed from the community or the competition for food/space is now significantly reduced due to more food/space in the community. </u>

3 0
2 years ago
Which of the following organisms reproduce sexually via an alternation of generations life cycle?
myrzilka [38]
It should be sporozoans
4 0
3 years ago
Other questions:
  • Describe how a farmer can maintain Genetic Stability in his crops??
    10·1 answer
  • Write a paragraph that explains how the water cycle works in your front yard
    12·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What controls when and how fast cells grow and divide?
    11·2 answers
  • Osmosis is a different type of blank diffusion
    9·1 answer
  • Many farmers and gardeners compost their plant and animal waste. The living material naturally decays in compost bins, forming a
    6·2 answers
  • Let’s follow the path of a delicious ham and cheese sandwich with lettuce and pickles as it is eaten and digested! Start at the
    12·1 answer
  • Please select the word from the list that best fits the definition
    10·2 answers
  • Explain how materials enter and leave the cell. Make sure you use some terms like diffusion, osmosis, active and passive transpo
    5·1 answer
  • Changes in state of matter
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!