1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
8

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use t

he RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Biology
1 answer:
vladimir1956 [14]3 years ago
5 0

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

You might be interested in
What is the protein in our finger nails ?
zalisa [80]

Answer:

Your nails are made of keratin. Keratin is a type of protein that forms the cells that make up the tissue in nails and other parts of your body.

7 0
3 years ago
Read 2 more answers
What are some points of cell theory
shtirl [24]

Answer:

all living organisms are formed from cells

all living cells reproduce

cells are the basic structural and functional unit of life

Explanation:

8 0
3 years ago
A teacher says she has identified an organism with these characteristics: eukaryotic, multicellular, autotrophic, and a cell wal
DiKsa [7]
Let's break down each of the words to find out what they mean.
Eukaryotic: This basically means that the organism in question has a nucleus and other membrane-bound organelles. This rules out bacteria and archaea.
Multicellular: The organism must be made up of one or more cells, so that rules out protists.   
Autotrophic: This means that the organism can make energy from inorganic substances via a light source or chemical energy. Finally, this rules out animals and fungi.
Cell wall: This also proves that the organism is a plant. Plants are the only organisms that have a cell wall made of cellulose; fungi have one, but they are made of chitin and glucans.

So, your answer is that the kingdom of the organism of a plant. 
4 0
3 years ago
Read 2 more answers
Viruses do not possess all the characteristics of life. Identify those characterustics that viruses display and those they don't
seraphim [82]
The main aspect of viruses that causes controversy over it being classified as living is its manner of reproduction.

Viruses do reproduce, like a living organism. However, they cannot do so without a host cell, so they are unable to reproduce on their own, which means that they are not living.

Hope this helps!
3 0
3 years ago
Which bone in the body that does not have any articulations with other bones?
Nadusha1986 [10]
The only bone of the body that does not articulate directly with any other bone is the Hyoid Bone.
8 0
4 years ago
Other questions:
  • The short-legged Ancon sheep is descended from a mutant ram discovered in Dover, Massachusetts in 1791. Why did this mutation be
    6·2 answers
  • Circular motion includes all curved paths, not just movement in full circles
    10·2 answers
  • What type of information do scientist use to determine the approximate age of the earth
    9·2 answers
  • Which step is the same in both forms of fermentation, as well as in cellular respiration?
    14·1 answer
  • What is the role of heat in forming natural gas
    10·1 answer
  • Which part of an amino acid gives it its unique identity? Which parts do all amino acids share?
    13·1 answer
  • Please help me it's due in an hour.
    13·1 answer
  • What is the weakest bone in your body?​
    8·1 answer
  • Does anyone how to do this on legends of learning
    7·1 answer
  • What do wolves eliminate from the population?
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!