1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
7nadin3 [17]
3 years ago
8

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use t

he RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA
Biology
1 answer:
vladimir1956 [14]3 years ago
5 0

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

You might be interested in
This part of the electromagnetic spectrum produces heat and with special equipment can locate people at night
Pie
I'm guessing infrared waves, not sure tho
7 0
3 years ago
Read 2 more answers
Had you been Louis Pasteur what would have been your reflections and conclusions based on this experiment?
TEA [102]
If I had been Louis Pasteur, my first reflection would be that the experiment was able to produce milk with longer shelf-life. From there, I would make inferences as to how it happened. I already have knowledge about microorganisms and how they react or degrade with heat and pressure. So, I would conclude that by subjecting the milk to that specific temperature and pressure, the microorganisms that cause spoilage are destroyed.
Later on, I would also realize that it's not only the spoilage-causing bacteria that are destroyed but also all the other microorganisms present in the milk examples of which are probiotics.
6 0
3 years ago
The ADME process that involves the movement of drug molecules from the site of administration, across cell membranes, and into t
horsena [70]

Answer: absorption

Explanation:  process from site of administration till it reaches circulatory  system.

8 0
2 years ago
Can anyone explain to me the "all or nothing law" of action potentials? I'm in a college physiology class, and I do not understa
AysviL [449]
The all or nothing law of action potentials mainly talks about how the axons in the neurons only fire when there is enough action potential to fire. If there is not enough action potential, then the neuron will not be able to send signals because the action potential does not fire because of the deficit.
8 0
3 years ago
Is it true that a lizard is the venomest creature?​
katovenus [111]

Explanation:

While most snakes and lizards in North America are not poisonous, a few species can seriously injure or kill someone with their venom if the bite isn't treated quickly. They include the rattlesnake, copperhead, cottonmouth, coral snake, Gila monster, and Mexican bearded lizard.

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which situation can result in negative population growth
    5·2 answers
  • What is the difference between the position of the surface proteins and the membrane -spanning proteins
    8·1 answer
  • What causes surface tension in water?
    15·1 answer
  • The release of ________ to muscle cell receptors triggers muscle contractions. ach serotonin dopamine adrenaline
    10·1 answer
  • Is CH4 organic or inorganic?
    7·1 answer
  • Select the correct location
    9·1 answer
  • Which are protists that act like fungi ?
    5·2 answers
  • Plant cell under a microscope
    7·1 answer
  • Which ball-and-socket joint is the most freely moveable joint in the body?
    12·2 answers
  • Organisms are motivated to achieve and maintain an ideal or optimal level of stimulation that maximizes their performance accord
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!