Question

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answer 1

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.