1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ahrayia [7]
3 years ago
11

BRAINLY TO WHOEVER CAN HELP

Biology
2 answers:
iogann1982 [59]3 years ago
5 0

Structure, I got the answer from quizlet, so it's probably right.

vlada-n [284]3 years ago
3 0

Answer:

B Structure :)

Explanation:

You might be interested in
What are other methods for mesureng bacterial growth<br>​
Strike441 [17]

Answer:

The size of a population of microorganisms in liquid culture may bemeasured by counting cells directly or by first diluting the original sample and then counting cell numbers (see below), or by taking some indirect method such as the turbidity (cloudiness) of the culture.

Explanation:

3 0
3 years ago
What law of motion states that if no Force acts on an object at rest it will remain at restbb​
Korvikt [17]
Hey there!

The answer is

Newtons first law of inertia. "An object with no net forces acting on it which is initially at rest will remain at rest. If it is moving, it will continue to move in a straight line with constant velocity"

Hope i helped!

Please mark me brainliest!!!!!
4 0
3 years ago
How is the object related to your skeletal system?
MariettaO [177]

Showing the strength of the bones  and the muscles and bones around it.

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Malignant tumors concentrate in lymph nodes with this disease:
telo118 [61]
Hodgkin's disease or hodgkin's lymphoma
6 0
3 years ago
Other questions:
  • Select all that apply. The five major striated muscle groups in the body are _____. neck arms chest abdominals hands legs back f
    14·2 answers
  • Discuss two ways that radiometric dating can be used to establish the age of a fossil.
    13·1 answer
  • How do dna molecules vary from one species to another?
    13·1 answer
  • Of the following experimental results, which is the best evidence that photosynthesis is more efficient at certain wavelengths o
    14·1 answer
  • The psychodynamic perspective originated with Sigmund Freud. True or False
    8·2 answers
  • You have spent time working with a population of beetles. Males range in size from 2 to 6 cm in body length. You realize that th
    5·2 answers
  • A strike-slip fault is the result of what type of stress?
    13·1 answer
  • Hello(: I need some help what is an <br><br> (Allele)
    12·1 answer
  • The national wildlife refuge provides land for fish, wildlife, and plants. please select the best answer from the choices provid
    6·1 answer
  • Why is the copernican revolution significant? select three options. few advancements in scientific knowledge were made. scientis
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!