1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lunna [17]
2 years ago
5

The body temperature of Srinath is 99°F.Is he suffering from fever? If so, why?​

Biology
1 answer:
kap26 [50]2 years ago
4 0
It is a low grade temperature or normal because the regular body temperature is 98.6°.
You might be interested in
Explain how diffusion limits the size of a cell.<br> 9th grade level
Arisa [49]

Answer:

Diffusion is powerful over a particular distance and bounds the size that a character cellular can gain.

Explanation: If cellular is an unmarried-celled microorganism, consisting of an amoeba, it is able to satisfy all of its nutrient and waste needs via diffusion. If the mobile is too massive, then diffusion is useless at finishing all of these responsibilities.

8 0
3 years ago
Read 2 more answers
What are the reactants in cellular respiration? what are the products?
Gwar [14]
Cellular respiration is the process of releasing energy from the food that one had taken. The reactants of the cellular respiration were both oxygen and glucose. The main product of this process would be ATP (adenosine phosphate) but could also be H2O and CO2. 
3 0
3 years ago
Read 2 more answers
What structure do white blood cells use to engulf bacteria when they do phagocytosis?
vesna_86 [32]

The engulfed object is thus enclosed within a membrane-bound vacuole called a phagosome. The phagocyte digests the ingested particle with hydrolytic enzymes, which are contained within membrane-enclosed sacs called lysosomes found within the cell.

6 0
3 years ago
Drag each tile to the correct box. Maria is playing basketball. She sees the ball being thrown at her. She lunges forward to gra
Diano4ka-milaya [45]

Answer:

Maria see the ball thrown at her

8 0
2 years ago
A briefly explain the genetic and evolutionary implications of lederberg and lederberg’s (1952 finding that mutations adapted to
balandron [24]
Lederbergs' experiment of the prevalence of mutations before selective culture was proved by replica plating. They spread bacteria on the plate and allowed them to grow. Next, they stamped the growth on the new plate which was already containing penicillin. The bacteria were able to grow on this plate, even when they never exposed to the antibiotic before. This proved that some of the bacteria were already mutated and were not as a result of exposure to selective culture conditions. 
7 0
3 years ago
Other questions:
  • Do you think flowchart is the best way to explain how the nervous system works to someone who's unfamiliar with the concept? Exp
    8·1 answer
  • Do you feel actions should always be led by love ??
    5·2 answers
  • One type of active transport is called cotransport. In cotransport, the energy available from an ion moving through a transport
    12·1 answer
  • Describe facilitated diffusion of ions through the channel proteins
    15·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which of the following is not a source of human impact on the marine environment? A. coastal development, both residential and i
    10·1 answer
  • What methods are used in the industry to determine the presence of biomolecules in food.
    12·1 answer
  • 4. Which are supposed to be healthier for humans to consume, saturated fats or unsaturated fats? Hypothesize what the types of b
    13·1 answer
  • What are two examples of organic molecules<br> that scientists think first formed?
    15·1 answer
  • Before the 1960s, most ecologists thought that the number of producers in an ecosystem was the only variable that limits the num
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!